Nishiyama Reservoir: Lead Sources,Inventory, and the Influence of the Nagasaki Atomic Bomb

Sediment core samples were obtained from Nishiyama Reservoir, 3 km east of the hypocenter of the Nagasaki atomic bomb, to evaluate both sources and inventories of lead delivery to the sediments. Using microwave digestions and ICP-MS analytical techniques, elevated concentrations of isotopically unique lead were identified in the 1945 sediment horizon. These results illustrate that the Nagasaki bomb attack can be linked with unique lead loading to the sediments in the region of the hypocenter. There is a possibility that the roll-up of in-situ lead accounted for a majority of the increase in lead flux delivered to reservoir sediments during the atomic bomb attack.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Alogliptin ameliorates postprandial lipemia and postprandial endothelial dysfunction in non- diabetic subjects: a preliminary report

Background

Osteoprotegerin is a member of the tumor necrosis factor-related family and inhibits RANK stimulation of osteoclast formation as a soluble decoy receptor. The goal of this study was to determine the relationship of serum osteoprotegerin with vascular calcification in patients with type 2 diabetes.

Methods

The subjects were 124 patients with type 2 diabetes mellitus, including 88 males and 36 females with a mean (± SD) age of 65.6 ± 8.2 years old. Serum levels of osteoprotegerin, osteocalcin, fibroblast growth factor 23 (FGF23), 25-hydroxyvitamin D3 and adiponectin were measured by ELISA. Vascular calcification in the cervical artery was examined by ultrasound sonography. The subjects were divided into 4 quartiles depending on serum osteoprotegerin levels.

Results

Vascular calcification was significantly higher in the 4th quartile and significantly lower in the 1st quartile of serum osteoprotegerin levels, compared to other quartiles. There were no differences in serum osteoprotegerin and vascular calcification among patients with different stages of diabetic nephropathy, but serum FGF23 levels were elevated in those with stage 4 diabetic nephropathy. Simple regression analysis showed that serum osteoprotegerin levels had significant positive correlations with age, systolic blood pressure and serum adiponectin levels, and significant negative correlations with BMI and serum 25-hydroxyvitamin D3.

Conclusions

These findings suggest that elevated serum osteoprotegerin may be involved in vascular calcification independently of progression of diabetic nephropathy in patients with type 2 diabetes.     

Tumor grafts derived from women with breast cancer authentically reflect tumor pathology, growth, metastasis and disease outcomes

Development and preclinical testing of new cancer therapies is limited by the scarcity of in vivo models that authentically reproduce tumor growth and metastatic progression. We report new models for breast tumor growth and metastasis in the form of transplantable tumors derived directly from individuals undergoing treatment for breast cancer. These tumor grafts illustrate the diversity of human breast cancer and maintain essential features of the original tumors, including metastasis to specific sites. Co-engraftment of primary human mesenchymal stem cells maintains phenotypic stability of the grafts and increases tumor growth by promoting angiogenesis. We also report that tumor engraftment is a prognostic indicator of disease outcome for women with newly diagnosed breast cancer; orthotopic breast tumor grafting is a step toward individualized models for tumor growth, metastasis and prognosis. This bank of tumor grafts also serves as a publicly available resource for new models in which to study the biology of breast cancer.     

Caffeine induces apoptosis by enhancement of autophagy via PI3K/Akt/mTOR/p70S6K inhibition

Caffeine is one of the most frequently ingested neuroactive compounds. All known mechanisms of apoptosis induced by caffeine act through cell cycle modulation or p53 induction. It is currently unknown whether caffeine-induced apoptosis is associated with other cell death mechanisms, such as autophagy. Herein we show that caffeine increases both the levels of microtubule-associated protein 1 light chain 3-II and the number of autophagosomes, through the use of western blotting, electron microscopy and immunocytochemistry techniques. Phosphorylated p70 ribosomal protein S6 kinase (Thr389), S6 ribosomal protein (Ser235/236), 4E-BP1 (Thr37/46) and Akt (Ser473) were significantly decreased by caffeine. In contrast, ERK1/2 (Thr202/204) was increased by caffeine, suggesting an inhibition of the Akt/mTOR/p70S6K pathway and activation of the ERK1/2 pathway. Although insulin treatment phosphorylated Akt (Ser473) and led to autophagy suppression, the effect of insulin treatment was completely abolished by caffeine addition. Caffeine-induced autophagy was not completely blocked by inhibition of ERK1/2 by U0126. Caffeine induced reduction of mitochondrial membrane potentials and apoptosis in a dose-dependent manner, which was further attenuated by the inhibition of autophagy with 3-methyladenine or Atg7 siRNA knockdown. Furthermore, there was a reduced number of early apoptotic cells (annexin V positive, propidium iodide negative) among autophagy-deficient mouse embryonic fibroblasts treated with caffeine than their wild-type counterparts. These results support previous studies on the use of caffeine in the treatment of human tumors and indicate a potential new target in the regulation of apoptosis.     

HMG domain containing SSRP1 is required for DNA demethylation and genomic imprinting in Arabidopsis

In Arabidopsis, DEMETER (DME) DNA demethylase contributes to reprogramming of the epigenetic state of the genome in the central cell. However, other aspects of the active DNA demethylation processes remain elusive. Here we show that Arabidopsis SSRP1, known as an HMG domain-containing component of FACT histone chaperone, is required for DNA demethylation and for activation and repression of many parentally imprinted genes in the central cell. Although loss of DNA methylation releases silencing of the imprinted FWA-GFP, double ssrp1-3;met1-3 mutants surprisingly showed limited activation of maternal FWA-GFP in the central cell, and only became fully active after several nuclear divisions in the endosperm. This behavior was in contrast to the dme-1;met1 double mutant in which hypomethylation of FWA-GFP by met1 suppressed the DNA demethylation defect of dme-1. We propose that active DNA demethylation by DME requires SSRP1 function through a distinctly different process from direct DNA methylation control.