Evidence suggesting that PrP is not the infectious agent in Creutzfeldt-Jakob disease.

It has been suggested that the infectious agents of scrapie and Creutzfeldt-Jakob disease (CJD) are 'prions' constituted by a protease resistant glycopeptide, PrP. To analyze the role of PrP in CJD infectivity we re-evaluated the biochemical characteristics of infectivity. First, when the infectious agent is not aggregated, infectivity is exquisitely sensitive to proteinase K treatment, and therefore a proteinase-K-resistant molecule (e.g. PrP) is unlikely to contain information essential for agent replication. Second, removal of sugar residues from Gp34 (the major precursor of the proteolyzed PrP band) failed to reduce infectivity. Third, one-half of the PrP peptides could be separated from significant infectivity using nondenaturing conditions with practical quantitative recovery of infectivity. These studies suggest that PrP in itself is unlikely to be the replicating component of the infectious agent. We suggest that these as yet undefined agents may consist of core protein and nucleic acid that are incompletely assembled in, and protected by, cell membranes. This hypothesis would explain the absence of conventional viral particles in these diseases, account for observed membrane pathology including altered behavior of endogenous membrane proteins, and would be consistent with the replication and transforming properties of CJD that indicate there is an agent specific nucleic acid.     

Xfin: an embryonic gene encoding a multifingered protein in Xenopus.

The Xenopus laevis genome was screened for putative DNA-binding gene products by using the 'finger' region of the Drosophila gene Krüppel as a probe. The one gene detected, named Xfin, codes for a protein with 37 finger domains that comprise nearly 90% of the protein. In the light of studies by Rhodes and Klug (Cell, 46, 123-132, 1986), these data suggest that the Xfin protein has the capacity to bind an unusually large stretch (185 bases) of DNA. The Xfin gene is expressed as a maternal and zygotic mRNA that undergoes extensive polyadenylation changes during early development. The Xfin mRNA expression pattern and the potential DNA binding activity of the protein point to the possibility that the Xfin gene may have a role in controlling gene activity during early embryonic development.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Ly1+ PRO-B lymphocyte clones. Phenotype, growth requirements and differentiation in vitro and in vivo.

Several clones obtained from the bone marrow of a BALB/c mouse were found to contain the heavy and light chain Ig genes in the germline configuration, to express Ly1 and to carry the B cell lineage markers B-220, Lyb8 and BP-1; these clones are Pgp-1+, LFA-1+, J11d+, Mac-1+ and Thy1-, Lyt2-, L3T4-, GM1.2- and Ia-. Three clones analyzed in detail (Lyd9, LyH7 and Lyb9) have receptors for interleukin (IL) 2 and IL3 as assessed with the 7D4 and CC11 monoclonal antibodies respectively. They grow in rIL3 but not in rIL2 or rIL1; both rIL4 and rIL5 also promote their proliferation, albeit to a much lesser extent than rIL3. None of the interleukins tested alone or in various combinations promoted the clones to differentiate in vitro along the B cell pathway. Treatment with 5-Azacytidine (5-Aza) induced cell surface Ia expression but not rearrangement or expression of Ig genes. However, 5-Aza-treated Lyd9, LyH7 and Lyb9 cells co-cultured with X-ray irradiated accessory cells and LPS gave rise to Ly1+, IgM+ B lymphocytes (range 14-51%) including mu + kappa + (78-93%), and mu + lambda + (9-25%) B lymphocytes. In vivo, the Lyd9, LyH7 and Lyb9 clones gave rise to IgM+ B lymphocytes (8.5-17%) including mu + kappa +, and mu + lambda +, but not to Lyt2+ or L3T4+ T lymphocytes after 4-6 weeks of transfer into Scid mice. Our results indicate that Ly1+ IgM+ cells comprise a subpopulation of B lymphocytes that is derived from IL3-responsive Ly1+ PRO-B lymphocytes.     

Endonuclease G: a (dG)n X (dC)n-specific DNase from higher eukaryotes.

An endonuclease activity (termed endonuclease G) that selectively cleaves DNA at (dG)n X (dC)n tracts has been partially purified from immature chicken erythrocyte nuclei. Sites where n greater than or equal to 9 are cleaved in a manner that resembles types II and III restriction nucleases. The nicking rate of the G-strand is 4- to 10-fold higher than that of the C-strand depending on the length of the (dG)n X (dC)n tract and/or nucleotide composition of the flanking sequences. Endonuclease G hydrolyzes (dG)24 X (dC)24 of supercoiled DNA in a bimodal way every 9-11 nucleotides, the maxima in one strand corresponding to minima in the opposite, suggesting that it binds preferentially to one side of the double helix. The nuclease produces 5' phosphomonoester ends and its activity is dependent on Mg2+ or Mn2+. The wide distribution and high relative activity of endonuclease G in a variety of tissues and species argues for a general role of the enzyme. The striking correlation between genetic instability and poly(dG) X poly(dC) tracts in DNA suggests that these sequences and endonuclease G are involved in recombination processes.     

Embryonal carcinoma-derived growth factor activates protein kinase C in vivo and in vitro.

We have recently reported that a polypeptide mitogen, the embryonal carcinoma-derived growth factor (ECDGF), induces phosphorylation of the epidermal growth factor (EGF) receptor in intact C3H 10T 1/2 mouse fibroblasts with concomittant loss of high affinity EGF binding sites. This phenomenon appears to be mediated through an activation of protein kinase C. Several groups have described an acidic 80,000 dalton protein substrate of protein kinase C. In this paper, we demonstrate that the addition of ECDGF or the phorbol ester TPA to intact C3H 10T 1/2 cells results in the enhanced phosphorylation of this 80 kd protein in vivo. Furthermore, this response is demonstrable in vitro. Thus the addition of ECDGF, the phorbol ester TPA, protein kinase C or phosphoinositidase C to crude membranes prepared from C3H 10T 1/2 cells resulted in the enhanced phosphorylation of this protein. Data obtained by phosphopeptide mapping of the 80 kd protein show that the ECDGF-induced activation of protein kinase C in our membrane preparations is comparable with that obtained in vivo. The availability of an in vitro system in which this response is preserved should now allow a detailed biochemical analysis of the steps between binding of a mitogen to its receptor and the activation of protein kinase C.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.