TGGE and HIEF: a comparison of two methods in the detection of carriers of the Z mutation of the alpha-1-antitrypsin gene

Alpha-1-antitrypsin (-1-AT) deficiency can lead to juvenile liver cirrhosis and lung emphysema in adulthood. The deficiency Z allele is caused by a base transition. Temperature gradient gel electrophoresis (TGGE) and hybrid isoelectric focusing (HIEF) were used to detect carriers of the Z mutation of the -1-AT gene. The resulting data were compared. To verify carriers at the sequence level, a manual nonradioactive sequencing strategy was established. Among our sample of carriers of the Z mutation, two were not detected by HIEF that could be identified by TGGE. DNA of all TGGE identified individuals harboring the Z mutation of the -1-AT gene were sequenced nonradioactively. All carriers harbored a G to A transition at position 11.940. This mutation is described to cause the altered protein.     

Progressive und regressive Hirngrößienveränderungen bei Equiden

Progressive and regressive changes of brain size within Equidae From Hyracotherium to Equus brain size increased eightfold independently from body size. In domestication brain size is reduced; within mammals the amount of reduction depends on cephalization. Species with high cephalization show much more reductions than those with low cephalization. Among the ancestors of domesticated mammals wild horses have the highest cephalization level; reduction of brain size of more than 30% in domesticated horses could be expected. The size of the brain case of domesticated horses is only 14 % smaller than in wild Przewalski horses. We think that populations of the wild Przewalski horses have been crossbreeds between wild and domesticated animals. There is no difference in size of the brain case capacity and the brain weight between the Przewalski horses from zoological gardens and domesticated horses. This may be due to further crossbreeding between Zoo-Przewalski horses and domesticated horses and to artificial selection.     

A rapid and efficient method to enrich SAF-protein from scrapie brains of hamsters

Scrapie hamster brains contain at least 5–10 g of scrapie-associated fibrils (SAF) per brain as estimated by the amount of its major constituent, a protein of about 26 000 daltons (SAF-protein). It can be extracted efficiently by a 10% solution of sarkosyl and can be enriched by differentia] centrifugation and buffer extraction. Scrapie infectivity, SAF, and SAF-protein copurify.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.