Absence of thrombin-activatable fibrinolysis inhibitor protects against sepsis-induced liver injury in mice

Thrombin-activatable fibrinolysis inhibitor (TAFI), also known as carboxypeptidase R, has been implicated as an important negative regulator of the fibrinolytic system. In addition, TAFI is able to inactivate inflammatory peptides such as complement factors C3a and C5a. To determine the role of TAFI in the hemostatic and innate immune response to abdominal sepsis, TAFI gene-deficient (TAFI-/-) and normal wild-type mice received an i.p. injection with Escherichia coli. Liver TAFI mRNA and TAFI protein concentrations increased during sepsis. In contrast to the presumptive role of TAFI as a natural inhibitor of fibrinolysis, TAFI-/- mice did not show any difference in E. coli-induced activation of coagulation or fibrinolysis, as measured by plasma levels of thrombin-anti-thrombin complexes and D-dimer and the extent of fibrin depositions in lung and liver tissues. However, TAFI-/- mice were protected from liver necrosis as indicated by histopathology and clinical chemistry. Furthermore, TAFI-/- mice displayed an altered immune response to sepsis, as indicated by an increased neutrophil recruitment to the peritoneal cavity and a transiently increased bacterial outgrowth together with higher plasma TNF-alpha and IL-6 levels. These data argue against an important part for TAFI in the regulation of the procoagulant-fibrinolytic balance in sepsis and reveals a thus far unknown role of TAFI in the occurrence of hepatic necrosis.     

Depth-of-Focus Correction in Single-Molecule Data Allows Analysis of 3D Diffusion of the Glucocorticoid Receptor in the Nucleus

Single-molecule imaging of proteins in a 2D environment like membranes has been frequently used to extract diffusive properties of multiple fractions of receptors. In a 3D environment the apparent fractions however change with observation time due to the movements of molecules out of the depth-of-field of the microscope. Here we developed a mathematical framework that allowed us to correct for the change in fraction size due to the limited detection volume in 3D single-molecule imaging. We applied our findings on the mobility of activated glucocorticoid receptors in the cell nucleus, and found a freely diffusing fraction of 0.49±0.02. Our analysis further showed that interchange between this mobile fraction and an immobile fraction does not occur on time scales shorter than 150 ms.     

Phyto-extraction of heavy metals and biochemical changes with Brassica nigra L. grown in rayon grade paper mill effluent irrigated soil

In this study, distribution of metal accumulation and their biological changes of Indian mustard plants (Brassica nigra L.) grown in soil irrigated with different concentration of rayon grade paper effluent (RGPE, 25%, 50%, 75%, 100%, v/v) were studied. A pronounced effect was recorded at 50% (v/v) RGPE on germination of seeds, amylase activity and other growth parameters in Indian mustard plants. An increase in the chlorophyll and protein contents was also recorded at <50% (v/v) RGPE followed by a decrease at higher concentrations of RGPE (>75%). A significant increase lipid peroxidation was recorded, which was evidenced by the increased malondialdehyde (MDA) content in shoot, leaves and seeds in tested plant at all the concentrations of RGPE. This Indian mustard plants (Brassica nigra L.) are well adapted for tolerance of significant amount of heavy metals due to increased level of antioxidants (cysteine and ascorbic acid) in root shoot and leaves of treated plants at all concentration of RGPE. Moreover, it is also important that RGPE should be treated to bring down the metal concentration well within the prescribed limit prior to use in agricultural soil for ferti-irrigation.     

Importance of the alpha 3-fragment of complement C4 for the binding with C4b-binding protein.

The human regulatory complement component C4b-binding protein (C4BP) is a multimeric plasma protein, which regulates the classical pathway of the complement system. C4BP functions as a cofactor to factor 1 in the degradation of C4b and accelerates the decay rate of the C4b2a complex. Previously, we have demonstrated that monoclonal antibodies (C4-2 and 9) directed against the alpha'-chain of C4b inhibit the binding of C4b to C4BP. In order to identify the structural domain of C4b that binds C4BP, proteolytic fragments of C4 were generated with trypsin and Staphylococcus aureus V8 protease. Sodium dodecyl sulfate polyacrylamide gel electrophoresis, immunoblotting and amino acid sequence analysis of the proteolytic fragments reactive with the anti-C4 mAb's revealed that the residues Ala738-Arg826 of the alpha 3-fragment of C4b are important for the interaction with C4BP.     

Receptor for Advanced Glycation End Products (RAGE) Serves a Protective Role during Klebsiella pneumoniae - Induced Pneumonia

Klebsiella species is the second most commonly isolated gram-negative organism in sepsis and a frequent causative pathogen in pneumonia. The receptor for advanced glycation end products (RAGE) is expressed on different cell types and plays a key role in diverse inflammatory responses. We here aimed to investigate the role of RAGE in the host response to Klebsiella (K.) pneumoniae pneumonia and intransally inoculated rage gene deficient (RAGE^-/-) and normal wild-type (Wt) mice with K. pneumoniae. Klebsiella pneumonia resulted in an increased pulmonary expression of RAGE. Furthermore, the high-affinity RAGE ligand high mobility group box-1 was upregulated during K. pneumoniae pneumonia. RAGE deficiency impaired host defense as reflected by a worsened survival, increased bacterial outgrowth and dissemination in RAGE^-/- mice. RAGE^-/- neutrophils showed a diminished phagocytosing capacity of live K. pneumoniae in vitro. Relative to Wt mice, RAGE^-/- mice demonstrated similar lung inflammation, and slightly elevated—if any—cytokine and chemokine levels and unchanged hepatocellular injury. In addition, RAGE^-/- mice displayed an unaltered response to intranasally instilled Klebsiella lipopolysaccharide (LPS) with respect to pulmonary cell recruitment and local release of cytokines and chemokines. These data suggest that (endogenous) RAGE protects against K. pneumoniae pneumonia. Also, they demonstrate that RAGE contributes to an effective antibacterial defense during K. pneumoniae pneumonia, at least partly via its participation in the phagocytic properties of professional granulocytes. Additionally, our results indicate that RAGE is not essential for the induction of a local and systemic inflammatory response to either intact Klebsiella or Klebsiella LPS.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia

Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI) in a well-established rat model of Streptococcus (S.) pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.     

The Polysaccharide Capsule of Streptococcus pneumonia Partially Impedes MyD88-Mediated Immunity during Pneumonia in Mice

Toll-like receptors (TLR) and the downstream adaptor protein MyD88 are considered crucial for protective immunity during bacterial infections. Streptococcus (S.) pneumoniae is a human respiratory pathogen and a large majority of clinical pneumococcal isolates expresses an external polysaccharide capsule. We here sought to determine the role of pneumococcal capsule in MyD88-mediated antibacterial defense during S. pneumonia pneumonia. Wild type (WT) and Myd88^-/- mice were inoculated intranasally with serotype 2 S. pneumoniae D39 or with an isogenic capsule locus deletion mutant (D39∆cps), and analysed for bacterial outgrowth and inflammatory responses in the lung. As compared to WT mice, Myd88^-/- mice infected with D39 demonstrated a modestly impaired bacterial clearance accompanied by decreased inflammatory responses in the lung. Strikingly, while WT mice rapidly cleared D39∆cps, Myd88^-/- mice showed 10⁵-fold higher bacterial burdens in their lungs and dissemination to blood 24 hours after infection. These data suggest that the pneumococcal capsule impairs recognition of TLR ligands expressed by S. pneumoniae and thereby partially impedes MyD88-mediated antibacterial defense.     

The effect of three years of TNF alpha blocking therapy on markers of bone turnover and their predictive value for treatment discontinuation in patients with ankylosing spondylitis: a prospective longitudinal observational cohort study

Introduction

Statins (hydroxymethylglutaryl coenzyme A reductase inhibitors) are effective in reducing the risk of cardiovascular morbidity and mortality in patients with hyperlipidemia, hypertension, or type II diabetes. Next to their cholesterol-lowering activity, statins have immunomodulatory properties. Based on these properties, we hypothesized that statin use may eventually lead to dysregulation of immune responses, possibly resulting in autoimmunity. We have recently shown in an observational study that statin use was associated with an increased risk of developing rheumatoid arthritis. Our objective was to investigate whether a causal relationship could be established for this finding.

Methods

The mouse collagen type II (CII)-induced arthritis (CIA) model was used, with immunization, challenge, and euthanasia at days 0, 21, and 42, respectively. Statins were given orally before (day -28 until day 21) or after (day 21 until day 42) CIA induction. Atorvastatin (0.2 mg/day) or pravastatin (0.8 mg/day) was administered. Arthritis was recorded three times a week. Serum anti-CII autoantibodies and cytokines in supernatants from Concanavalin-A-stimulated lymph node cells and CII-stimulated spleen cells were measured.

Results

Statin administration accelerated arthritis onset and resulted in 100% arthritic animals, whereas only seven out of 12 nonstatin control animals developed arthritis. Atorvastatin administration after CIA induction resulted in earlier onset than atorvastatin administration before induction, or than pravastatin administration before or after induction. The arthritic score of animals given pravastatin before CIA induction was similar to that of the nonstatin controls, whereas the other groups that received statins showed higher arthritic scores. Atorvastatin administration, especially before CIA induction, increased anti-CII autoantibody production. IL-2 and IL-17 production by lymph node and spleen cells was higher in CIA animals than in PBS controls, but was not affected by statin administration. While IFN?? production was not affected by CIA induction, atorvastatin administration before CIA induction increased the production of this cytokine.

Conclusion

These data support previous results from our observational studies, indicating a role for statins in the induction of autoimmunity.