Phytochemical Compounds from the Crop Byproducts of Tunisian Globe Artichoke Cultivars

The phytochemical composition in two Tunisian globe artichoke cultivars (bracts, leaves, and floral stems) was evaluated in the plant byproducts. The results indicated that the bracts contain the highest levels of total phenols, o‐diphenols, and flavonoids, whereas tannins seem to be more abundant in the leaves. Bracts from the ‘Violet d'Hyères’ cultivar possessed more total phenols (160.8 mg/g DW), flavonoids (64.9 mg/g DW), and anthocyanins (15.3 μg/g DW) than the ‘Blanc d'Oran’ bracts (134.5 mg/g DW, 51.2 mg/g DW, and 8.3 μg/g DW, resp.). Sixty‐four volatile compounds were identified in the headspace of globe artichoke material, particularly in the bracts. The volatile profile showed that sesquiterpene hydrocarbons and non‐terpene derivatives were the main volatiles emitted by the bracts in both cultivars. These results suggest that globe artichoke byproducts might represent a potential source of natural compounds, which could be used as nutraceuticals or as ingredients in the design of functional foods.     

Intense Chiral Optical Phenomena in Racemic Polymers by Cocrystallization With Chiral Guest Molecules: A Brief Overview

This review is devoted to the chiral optical behavior of films of racemic polymers whose chirality is induced by cocrystallization with nonracemic (also temporary) guest molecules. We provide examples of macromolecular amplification of chirality, produced by molecular and supramolecular mechanisms, on industrially relevant polymers like poly(2,6‐dimethyl‐1,4‐phenylene)oxide (PPO) and syndiotactic polystyrene (s‐PS). Chirality 28:29–38, 2016. © 2015 Wiley Periodicals, Inc.     

Rapid method to obtain high quality nuclear and chromosome images directly from living cells in the Characeae

This study focused on a method based on the capacity of cationic dyes to stain only the nucleus and chromosomes in cells subjected to either acid or alkaline hydrolysis. The method and the squash were optimized for the Characeae and were described in detail. Nuclei from vegetative shoot apices and antheridial filament cells of unfixed, fixed and herbarium material of Nitella opaca were investigated using the Azure A or Toulidine Blue stains. Comparisons with some other staining methods, used in the previous studies, were also reported. The Azure A/Toulidine Blue method is useful to obtain clear images of chromosome morphology comparable or higher to that obtained with Feulgen or Aceto‐Orcein. It requires little time and a less complicated procedure in comparison with other staining methods.     

Protein structure prediction assisted with sparse NMR data in CASP13

CASP13 has investigated the impact of sparse NMR data on the accuracy of protein structure prediction. NOESY and ¹⁵N-¹H residual dipolar coupling data, typical of that obtained for ¹⁵N,¹³C-enriched, perdeuterated proteins up to about 40 kDa, were simulated for 11 CASP13 targets ranging in size from 80 to 326 residues. For several targets, two prediction groups generated models that are more accurate than those produced using baseline methods. Real NMR data collected for a de novo designed protein were also provided to predictors, including one data set in which only backbone resonance assignments were available. Some NMR-assisted prediction groups also did very well with these data. CASP13 also assessed whether incorporation of sparse NMR data improves the accuracy of protein structure prediction relative to nonassisted regular methods. In most cases, incorporation of sparse, noisy NMR data results in models with higher accuracy. The best NMR-assisted models were also compared with the best regular predictions of any CASP13 group for the same target. For six of 13 targets, the most accurate model provided by any NMR-assisted prediction group was more accurate than the most accurate model provided by any regular prediction group; however, for the remaining seven targets, one or more regular prediction method provided a more accurate model than even the best NMR-assisted model. These results suggest a novel approach for protein structure determination, in which advanced prediction methods are first used to generate structural models, and sparse NMR data is then used to validate and/or refine these models.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Heterologous expression of bovine and porcine beta-lactoglobulins in Pichia pastoris: towards a comparative functional characterisation

Bovine and porcine beta-lactoglobulins were cloned and expressed in host cells with the aim of developing the tools necessary for their structural, functional and conformational characterisation by NMR techniques. Both lipocalins were expressed in Pichia pastoris, where the use of a constitutive promoter turned out to allow the highest productivity. The yield of recombinant proteins was further improved through multiple integration of the encoding genes and by increasing aeration of the transformed cultures. Both proteins were obtained in the culture medium at the concentration of 200 microg/ml. Recombinant lipocalins were purified by ion-exchange chromatography from the culture medium. A preliminary NMR characterisation showed that both proteins were correctly folded.