A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Ploidy reduction and genome segregation in cultured carrot cell lines. I. Prophase chromosome reduction

Cytological analysis of different carrot cell lines in culture has shown various cytogenetic anomalies generating new levels of ploidy and novel chromosome numbers. Polyploidy may be considered a reservoir of variability that can be released in the form of distinct new segregants of different ploidy. Mechanisms alternative to mitosis (reductional grouping, prophase chromosome reduction) operate from a polyploid state (possibly reached by means of endopolyploidy, endomitosis, nuclear fusion, or restitution nuclei) to generate new levels of ploidy and novel chromosome numbers necessary for selection to operate in vitro. The segregational phenomena require chromosome recognition in haploid set complements and abnormal behaviour of mitoses; the resulting chromosome variability suggests that chromosomes are arranged, in the resting nuclei, in an orderly and predictable manner.The knowledge of the molecular events governing these mechanisms, and how to control them, would be of great help for future applications of plant cell culture.     

Study of the mechanism of Corynebacterium parvum antitumour activity: Protective effect in mice submitted to sublethal doses of irradiation

Summary The antitumour activity of C. parvum against two different tumours, a lymphosarcoma grafted in XVII mice and a mammary carcinoma grafted in C₃H mice, was a radiosensitive phenomenon. A dose of X-rays as low as 100 rads was sufficient to abrogate the C. parvum-induced protection. The duration of this inhibition increased with augmentation of the X-ray dose. The stimulation of macrophage-phagocytic activity induced by C. parvum was not inhibited by a dose of 500 rads. A chronological parallelism has been demonstrated in the recovery of the C. parvum antitumour effect and the restoration of antibody responsiveness after the suppression of these two activities by 500 rads of X-rays in the case of the C₃H mice grafted with mammary carcinoma cells. No such concomitant recovery has been observed in XVII mice. In these mice, the recovery of C. parvum antitumour activity took place before the restoration of antibody responsiveness.     

Lipid-protein interactions at the erythrocyte membrane. Different influence of glucose and sorbose on membrane lipid transition

When observed over a temperature range, erythrocyte membrane lipids undergo a transition at 18–20 °C (Zimmer, G. and Shirmer, H. (1974) Biochim. Biophys. Acta 345, 314–320). This observation has prompted an investigation of the effects that substrate binding has on the transition of the red cell membrane. Glucose and sorbose were compared, since transport kinetics of these sugars still pose unresolved questions.In membranes, preloaded with glucose, the break at the transition temperature was intensified, while it was abolished or reversed in membranes preloaded with sorbose.These results were corroborated using different solubilization procedures (sonication, sodium dodecyl sulfate treatment) of the membranes, and also different techniques (viscosimetry, 90° light scattering, 1-anilino-naphthalene-8-sulfonate fluorescence).In extracted membrane lipids, viscosimetry indicated a break at transition temperature after preloading with either glucose or sorbose.Disc electrophoresis revealed a different binding pattern of the two sugars.It is suggested, that the amplification of the discontinuity in red cell membranes by glucose and the abolition or reversal of the break by sorbose are mediated by membrane protein- and/or membrane lipid-protein interaction.     

SCRaPL: A Bayesian hierarchical framework for detecting technical associates in single cell multiomics data

Single-cell multi-omics assays offer unprecedented opportunities to explore epigenetic regulation at cellular level. However, high levels of technical noise and data sparsity frequently lead to a lack of statistical power in correlative analyses, identifying very few, if any, significant associations between different molecular layers. Here we propose SCRaPL, a novel computational tool that increases power by carefully modelling noise in the experimental systems. We show on real and simulated multi-omics single-cell data sets that SCRaPL achieves higher sensitivity and better robustness in identifying correlations, while maintaining a similar level of false positives as standard analyses based on Pearson and Spearman correlation.     

Effect of hemicellulose and lignin removal on enzymatic hydrolysis of steam pretreated corn stover

Ethanol can be produced from lignocellulosic biomass using steam pretreatment followed by enzymatic hydrolysis and fermentation. The sugar yields, from both hemicellulose and cellulose are critical parameters for an economically-feasible ethanol production process. This study shows that a near-theoretical glucose yield (96-104%) from acid-catalysed steam pretreated corn stover can be obtained if xylanases are used to supplement cellulases during hydrolysis. Xylanases hydrolyse residual hemicellulose, thereby improving the access of enzymes to cellulose. Under these conditions, xylose yields reached 70-74%. When pre-treatment severity was reduced by using autocatalysis instead of acid-catalysed steam pretreatment, xylose yields were increased to 80-86%. Partial delignification of pretreated material was also evaluated as a way to increase the overall sugar yield. The overall glucose yield increased slightly due to delignification but the overall xylose yield decreased due to hemicellulose loss in the delignification step. The data also demonstrate that steam pretreatment is a robust process: corn stover from Europe and North America showed only minor differences in behaviour.     

The determinants of stability in the human prion protein: insights into folding and misfolding from the analysis of the change in the stabilization energy distribution in different conditions

The dynamic evolution of the PrP(C) from its NMR-derived conformation to a beta-sheet-rich, aggregation-prone conformation is studied through all-atom, explicit solvent molecular dynamics in different temperature and pH conditions. The trajectories are analyzed by means of a recently introduced energy decomposition approach aimed at identifying the key residues for the stabilization and folding of the protein. It is shown that under native conditions the stabilization energy is concentrated in regions of the helices H1 and H3, whereas under misfolding conditions (low pH, high temperature, or mutations in selected sites) it is spread out over helix H2. Misfolding appears to be a rearrangement of the chain that disrupts most of the native secondary structure of the protein, producing some beta-rich conformations with an energy distribution similar to that of the native state.