Zur überwindung der biologischen Grenze Meer—Land durch Mollusken

Zusammenfassung Je höher marine Gastropoden ins Supralitoral vordringen, umso größer wird ihre Salinitätstoleranz. Das äußert sich im Überleben auf extremen Salinitäten, in der Waschstumsgeschwindigkeit und in der Fortpflanzungsrate.Die toleranz wird bei den drei großen Gastropodengruppen—Opisthobranchier (Limapontia depressa)—Prosobranchier (Assiminea grayana)—Pulmonaten (Ovatella myosotis)—im niedrigsalzigen Bereich durch Entwicklung einer Hypertonieregulation und bei hoher Salinität durch Poikilosmotie ermöglicht. Während adulte Schnecken des Supralitorals große Schwankungen im Salzgehalt ertragen, sind die Eier dagegen sehr empfindlich; Embryonen entwickeln sich bevorzugt bei Salinitäten, bei denen die Gelege von den Adulten produziet wurden.

---

The emigration of Gastropods from the seaII. Studies on Limatpontia capitata, L. depressa und Assiminea grayana

Summary The higher marine Gastropods live on the shore the more their salinity tolerance increases. This is expressed in the animals' survival, their growth rate, and their reproduction rate on extreme salinity concentrations. In all the three gastropod groups—Opisthobranchia (Limapontia depressa), Prosobranchia (Assiminea grayana), Pulmonata (Ovatella myosotis)—a more or less effective hyperosmotic regulation has evolved which enables the animals to live with low salinity concentrations in their surrounding. In high salinities they are poikilosmotic. Adult supralittoral Gastopods can stand considerable salinity changes. The eggs are more delicate: The embryos develop best when the eggs stay on the salinity where they were produced even if the concentrations are extremely high or low.

     

Kinetic relations of the Na-amino acid interaction at the mucosal border of intestine

The relation between unidirectional influxes of Na and amino acids across the mucosal border of rabbit ileum was studied under a variety of conditions. At constant Na concentration in the mucosal bathing solution, amino acid influx followed Michaelis-Menten kinetics permitting determination of maximal influx and the apparent Michaelis constant, K_t. Reduction in Na concentration, using choline as substitute cation, caused an increase in K_t for alanine but had no effect on maximal alanine influx. The reciprocal of K_t was a linear function of Na concentration. Similar results were obtained for valine and leucine and these amino acids competitively inhibited alanine influx both in the presence and in the absence of Na. These results lead to a model for the transport system which involves combination of Na and amino acid with a single carrier or site leading to penetration of both solutes. The model predicts that alanine should cause an increase in Na influx and the ratio of this extra Na flux to alanine flux should vary with Na concentration. The observed relation agreed closely with predicted values for Na concentrations from 5 to 140 mM. These results support the hypothesis that interactions between Na and amino acid transport depend in part on a common entry mechanism at the mucosal border of the intestine.     

Apparatus for monitoring the oxygen uptake and carbon dioxide production of fermentations

The requirements of the continuous analysis of effluent gas streams from aerated flash and tank fermentors are described, as are instrumental devices for measuring the oxygen and carbon dioxide content of fermentor gases. The use of a specially designed sequential gas sample for monitoring four fermentations simultaneously and a system for precise control of low air flow and pressure is explained. Equations for calculating carbon dioxide production or oxygen consumption rates and respiratory quotients are given. A discussion of the operating characteristics of a device for automatic translation of aeration data between fermentors is presented.     

Indirekte Regelmechanismen der Stoffwechselgröße von Fischen

Metabolic rate does not strictly follow changes of influencing parameters. O₂-consumption by fish is ordinarily said to be independent from O₂-pressure throughout a wide range. This constancy is probably the result of a regulation. The metabolic rate itself or an auxiliary mechanism “before” or “after” metabolism may be regulated. On the basis of vanDam's paper (1938) and our own experiments, the problem whether or not O₂-pressure in blood serves as a regulated auxiliary mechanism in order to maintain a certain metabolic constancy is discussed. The disadvantage of such a regulation would be the energy demand of increased ventilation and circulation as compensating mechanisms. In accordance with this assumption we have found a rise in O₂-consumption at a somewhat reduced O₂-pressure. Locomotory behaviour supports the constancy of metabolic rate; thus a contrary shift of the temperature preferendum after application of substances which influence metabolism has been found.     

Variation in nitrate metabolism in biovars of Pseudomonas solanacearum

A collection of 327 strains of Pseudomonas solanacearum , representing five biovars, was divisible into three groups on the basis of differences in nitrate metabolism. Nine strains (2.8%), of which seven were biovar 2 from bacterial wilt of potato, were nitrate reduction-deficient and failed to produce nitrite from nitrate by either of two methods of detection in five different media. A second group of 231 strains, comprising biovars 1 and 2 and a single biovar 3 strain, produced nitrite from nitrate and grew vigorously in the presence of nitrate under anaerobic conditions but were deficient in ability to denitrify. A third group comprising 57 strains of biovar 3, 28 of biovar 4 and one each of biovar 2 and 5 produced nitrite from nitrate and gave profuse growth and gas production from nitrate under anaerobic conditions. However, production of gas from nitrate (denitrification) was not a consistently reproducible property in some of the media tested. Gas production results were most reproducible when a semi-solid succinate/nitrate or glycerol/nitrate medium was used. Serial passage of four nitrate reduction-deficient isolates in nitrate medium did not restore ability to reduce nitrate.     

Methods of assessment of transfer of a gentamycin-resistance gene (aacC1) from genetically engineered microorganisms into agriculturally important soil bacteria

In order to assess the risk associated with the deliberate release of genetically engineered microorganisms (GEMs) into the agricultural environment, the transfer of plasmids between bacterial strains was investigated under laboratory conditions. Genetically modified Rhizobium leguminosarum and Agrobacterium tumefaciens strains carrying the gentamycin acetyltransferase resistance gene (aacC1) on various plasmids were investigated for their ability to transfer the aacC1 gene to their wild-type (w.t.) counterparts, as well as to Pseudomonas syringae. Conjugation experiments between the various strains, were carried out after the relevant characteristics and conditions for selective growth of each bacterial strain had been ascertained. After conjugations on filters had been completed, the putative transconjugants were grown in media containing antibiotics and assessed for the presence of aacC1 gene by: (a) DNA plasmid profile; (b) expression of AAC(3)-I enzyme activity; (c) colony hybridization using a ³²P-labelled DNA probe complementary to the aacC1 gene. The results obtained indicate that transfer of the aacC1 gene from genetically modified strains of R. leguminosarum into a plasmid-free strain of A. tumefaciens occurred via self-transmissible plasmids. Alternatively, genetically modified A. tumefaciens bearing the aacC1 gene on plasmids acquired from R. leguminosarum strains, transferred it ineffectively to a hardly detectable frequency. No transfer of the aacC1 gene from genetically modified R. leguminosarum or A. tumefaciens strains into P. syringae has been observed. These data indicate that in the absence of the RP4 element, genetically modified A. tumefaciens is not able to efficiently transfer aacC1 into w.t. R. leguminosarum and P. syringae. Correspondence to: A. S. Tsiftsoglou     

Expression of A mating type genes of Coprinus cinereus in a heterologous basidiomycete host

The A mating factor of Coprinus cinereus determines compatibility in mating by regulating part of a developmental sequence that leads to dikaryon formation. The A genes that trigger development encode two different classes of homeodomain proteins, and for a successful mating, a protein of one class, HD 1, must interact with a protein of the other class, HD 2. In this report we show that C. cinereus A genes that encode HD 2 proteins, a2-1 and b2-1, can elicit A-regulated development in the heterologous host C. bilanatus. Transformation rates were very low, suggesting that the genes were poorly transcribed. The fact that the HD 2 genes are functionally expressed implies successful heteromultimeric association of putative DNA-binding proteins coded by the two Coprinus species. This interaction was sufficient to satisfy the need for different A factors in the formation of a fertile C. bilanatus dikaryon, but fertile dikaryons were more readily produced in matings with the a2-1 gene transformants. The C. cinereus A genes, b1-1 and d1-1, which encode HD1 proteins, were either not expressed or their proteins were non-functional in C. bilanatus. These experiments raise some interesting questions regarding HD1–HD2 protein interactions.     

The goblet cavity matrix in the larval midgut of Hyalophora cecropia

The larval midgut of the silkmoth Hyalophora cecropia was examined using scanning electron microscopy. Goblet cells were observed to contain within their cavities a matrix plug. This matrix material was extruded onto the lumen side of the epithelium when the tissue was stretched. The rôle of this matrix material in maintenance of the capacity of the midgut to transport ions in vivo and in vitro is discussed.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.