Effects of phosphorylation of P-glycoprotein on multidrug resistance

Cells expressing elevated levels of the membrane phosphoprotein P-glycoprotein exhibit a multidrug resistance phenotype. Studies involving protein kinase activators and inhibitors have implied that covalent modification of P-glycoprotein by phosphorylation may modulate its biological activity as a multidrug transporter. Most of these reagents, however, have additional mechanisms of action and may alter drug accumulation within multidrug resistant cells independent of, or in addition to their effects on the state of phosphorylation of P-glycoprotein. The protein kinase(s) responsible for P-glycoprotein phosphorylation has(ve) not been unambiguously identified, although several possible candidates have been suggested. Recent biochemical analyses demonstrate that the major sites of phosphorylation are clustered within the linker region that connects the two homologous halves of P-glycoprotein. Mutational analyses have been initiated to confirm this finding. Preliminary data obtained from phosphorylation- and dephosphorylation-defective mutants suggest that phosphorylation of P-glycoprotein is not essential to confer multidrug resistance.     

Excess of deletions of maternal origin in the DiGeorge/Velo-cardio-facial syndromes. A study of 22 new patients and review of the literature

We have determined the parental origin of the deleted chromosome 22 in 29 cases of DiGeorge syndrome (DGS) using a CA-repeat mapping within the commonly deleted region, and in one other case by using a chromosome 22 short arm heteromorphism. The CA-repeat was informative in 21 out of 29 families studied and the deleted chromosome was of maternal origin in 16 cases (72%). When these data are pooled with recent results from the literature, 24 de novo DGS, velo-cardio-facial syndrome (VCFS) and isolated conotruncal cardiac disease deletions are found to be of maternal origin and 8 of paternal origin, yielding a ² of 8 with a probability level lower than 0.01. These data, and review of the literature on familial DGS/VCFS and isolated conotruncal cardiopathies suggest that there is a strong tendency for the 22q11.2 deletions to be of maternal origin.     

Argyrophilic nucleolar organizer regions

Silver staining techniques developed to demonstrate argyrophilic nucleolar organizer regions (Ag-NORs) have been widely applied in a variety of cell kinetic studies, using the mean number of AgNORs in tumour cells as a marker for malignancy of certain types of neoplasms. However, the AgNOR techniques currently available are not entirely satisfactory, as unspecific silver precipitates readily form in the sections. On the other hand, the contrast staining, may be so weak as to render identification of the AgNORs difficult. In the present study, some of the key factors influencing the outcome of AgNOR staining were evaluated in a more systematic way. A modified AgNOR staining procedure is now proposed, giving highly contrasting AgNORs with minimal unspecific silver precipitation, thus facilitating both manual and computerized counting. The new technique involves the use of microwave irradiation in order to shorten the processing time, the use of gelatin as a protective colloid, and a Farmer's solution to optimize the specificity of the technique.     

Elimination of the yeastCandida parapsilosis from lymphoid cells and monolayer cells in culture

Summary In our laboratory, airborne yeast contaminants of cell cultures have consistently been of the genusCandida (speciesCandida parapsilosis), which are difficult to control with fungicidal agents. To salvage cell lines that show the presence of this fungus, two effective methods may be employed. In early stages of infection, the addition of activated mouse peritoneal macrophages (5×10⁵ cells/ml) to the culture medium containing 5 μg Fungizone/ml eliminates all spores by phagocytosis. More heavily contaminated cultures can be depleted of fungi by density centrifugation on a layer of 38% Percoll. Remaining single spores, often not detectable by light microscopy, can be removed by the addition of macrophages (2×10⁵/ml) and Fungizone (5 μg/ml) to the culture medium. Contaminated monolayer cells can be freed of blastospores by several washes with balanced salt solution and subsequent culturing for 4 d in medium containing 10 μg Fungizone/ml without any toxic effects to the cells. These procedures can rescue valuable cell lines and hybridomas that would otherwise be lost. This work was supported by Veterans Administration Research Funds.     

Cytomorphogenetic- and anti-microtubule action of the antibiotic gougerotin inMicrasterias denticulata Bréb.

Summary Differentiating cells ofMicrasterias denticulata have been treated with aqueous solutions of the antibiotic gougerotin. Strong and characteristic cytomorphogenetic aberrations, resembling those of the anuclear type of development could be observed. It has been speculated that the aberrant growth of the growing half cell is the result of inhibition of protein synthesis by gougerotin.In addition to the morphogenetic influence, nuclear migration has been strongly inhibited by the drug. Therefore, it might be suggested that gougerotin is an active anti-microtubule agent.     

Tissue specific nuclear antigens in the germinal vesicle ofXenopus laevis oocytes

Summary A library of hybridoma cell lines has been established which produce monoclonal antibodies against antigens from the germinal vesicle ofXenopus laevis oocytes. Many of the antigens are also found in the nuclei ofXenopus embryonic cells in culture. The fate of two of these antigens during embryogenesis was traced by immunofluorescence on embryo and tadpole sections. Early in development these antigens appear to be evenly distributed in the nuclei of all cells. In later stages they gradually disappear from most embryonic structures but are strongly accumulated in the nuclei of some specific cell types and organs.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Photooxidation reactions of diphenylcarbazide and their DCMU-sensitivity in thylakoids of the blue-green alga Oscillatoria chalybea

Thylakoids of Oscillatoria chalybea are able to split water. The Hill reaction of these thylakoids is sensitive to DCMU. Diphenylcarbazide can substitute for water as the electron donor to photosystem II with these fully functioning thylakoids. However, the diphenylcarbazide photooxidation is completely insensitive to 3-(3,4-dichlorophenyl)-N-N-dimethyl urea (DCMU) at high diphenylcarbazide concentrations. In with Tris-treated Oscillatoria thylakoids the water splitting capacity is lost and diphenylcarbazide restores electron transport through photosystem II as occurs with higher plant chloroplasts. However, also these photoreactions are insensitive to DCMU. If diphenylcarbazide acts in Oscillatoria as an electron donor to photosystem II the result suggests that diphenylcarbazide feeds in its electrons behind the DCMU inhibition site. This in turn indicates that in Oscillatoria the site of inhibition of DCMU is on the donor side of photosystem II.Abbreviations Used DCMU 3-(3,4-dichlorophenyl)-N-N-dimethyl urea - DPC diphenylcarbazide - DCPiP 2,6-dichlorophenol indophenol - TMB tetramethyl benzidine - A-2-sulf anthraquinone-2-sulfonate     

Characterization of a variant of carcinoembryonic antigen (CEA) using monoclonal and polyclonal anti-CEA antibodies

A variant of the carcinoembryonic antigen (CEA) with lower molecular weight than a CEA reference preparation has been separated from CEA. Using a polyclonal, spleen absorbed anti-CEA antiserum, the variant crossreacts with reference CEA in immunodiffusion. The CEA-activity of the variant has been demonstrated using an enzyme-immunoassay with monoclonal CEA specific antibodies. There is sufficient immunological evidence that this variant is a distinct antigen different from the crossreactive antigens described so far. The reactivity of the polyclonal anti-CEA antiserum with the CEA variant was abolished by absorption against the immobilized variant.