Elimination of the yeastCandida parapsilosis from lymphoid cells and monolayer cells in culture

Summary In our laboratory, airborne yeast contaminants of cell cultures have consistently been of the genusCandida (speciesCandida parapsilosis), which are difficult to control with fungicidal agents. To salvage cell lines that show the presence of this fungus, two effective methods may be employed. In early stages of infection, the addition of activated mouse peritoneal macrophages (5×10⁵ cells/ml) to the culture medium containing 5 μg Fungizone/ml eliminates all spores by phagocytosis. More heavily contaminated cultures can be depleted of fungi by density centrifugation on a layer of 38% Percoll. Remaining single spores, often not detectable by light microscopy, can be removed by the addition of macrophages (2×10⁵/ml) and Fungizone (5 μg/ml) to the culture medium. Contaminated monolayer cells can be freed of blastospores by several washes with balanced salt solution and subsequent culturing for 4 d in medium containing 10 μg Fungizone/ml without any toxic effects to the cells. These procedures can rescue valuable cell lines and hybridomas that would otherwise be lost. This work was supported by Veterans Administration Research Funds.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Photooxidation reactions of diphenylcarbazide and their DCMU-sensitivity in thylakoids of the blue-green alga Oscillatoria chalybea

Thylakoids of Oscillatoria chalybea are able to split water. The Hill reaction of these thylakoids is sensitive to DCMU. Diphenylcarbazide can substitute for water as the electron donor to photosystem II with these fully functioning thylakoids. However, the diphenylcarbazide photooxidation is completely insensitive to 3-(3,4-dichlorophenyl)-N-N-dimethyl urea (DCMU) at high diphenylcarbazide concentrations. In with Tris-treated Oscillatoria thylakoids the water splitting capacity is lost and diphenylcarbazide restores electron transport through photosystem II as occurs with higher plant chloroplasts. However, also these photoreactions are insensitive to DCMU. If diphenylcarbazide acts in Oscillatoria as an electron donor to photosystem II the result suggests that diphenylcarbazide feeds in its electrons behind the DCMU inhibition site. This in turn indicates that in Oscillatoria the site of inhibition of DCMU is on the donor side of photosystem II.Abbreviations Used DCMU 3-(3,4-dichlorophenyl)-N-N-dimethyl urea - DPC diphenylcarbazide - DCPiP 2,6-dichlorophenol indophenol - TMB tetramethyl benzidine - A-2-sulf anthraquinone-2-sulfonate     

Characterization of a variant of carcinoembryonic antigen (CEA) using monoclonal and polyclonal anti-CEA antibodies

A variant of the carcinoembryonic antigen (CEA) with lower molecular weight than a CEA reference preparation has been separated from CEA. Using a polyclonal, spleen absorbed anti-CEA antiserum, the variant crossreacts with reference CEA in immunodiffusion. The CEA-activity of the variant has been demonstrated using an enzyme-immunoassay with monoclonal CEA specific antibodies. There is sufficient immunological evidence that this variant is a distinct antigen different from the crossreactive antigens described so far. The reactivity of the polyclonal anti-CEA antiserum with the CEA variant was abolished by absorption against the immobilized variant.     

Purification and characterization of recombinant Pneumocystis carinii thymidylate synthase

Gatalytically active Pneumocystis carinii thymidylate synthase is expressed to the extent of about 4% of the soluble protein in Escherichia coli χ2913 harboring plasmid pUETS-1.8 (U. Edman, J. C. Edman, B. Lundgren, and D. V. Santi, Proc. Natl. Acad. Sci. USA 86, 6503–6507, 1989). Ion-exchange, affinity, hydrophobic, and reactive dye agarose chromatography steps were explored to devise a large-scale purification protocol for P. carinii thymidylate synthase. Sequential DE52, Q-Sepharose, phenyl-Sepharose, and Cibacron Blue F3GA chromatography yielded enzyme that was homogeneous by SDS-PAGE in a yield of over 50%. The sequence of the first 10 amino acid residues of the purified protein was in accord with that predicted from the DNA sequence. Isoelectric focusing gave a pI of 6.2. Kinetic analysis of the purified enzyme revealed that the the K_m values were 4.7 ± 1.3 μM for dUMP and 15.7 ± 4.3 μM for 5,10-methylenetetrahydrofolate, similar to those of many other thymidylate synthases; the κ_cat of the most active preparation was 0.8 s⁻¹. The enzyme is stable for at least 2 months when stored at −80°C in the presence of 40% glycerol, Tris-HCl, and thiol.     

The Binding Properties of the Particulate and Solubilized Sulfonylurea Receptor from Cerebral Cortex Are Modulated by the Mg2+ Complex of ATP

Glibenclamide closes an ATP-sensitive K+ channel (K-ATP channel) by interaction with the sulfonylurea receptor in the plasma membrane of pancreatic B cells and thereby initiates insulin release. Previous studies demonstrated that the Mg2+ complex of ATP decreases glibenclamide binding to the sulfonylurea receptor from pancreatic islets. The aim of the present study was to examine the effect of adenine and guanine nucleotides on binding of sulfonyl-ureas to the cerebral sulfonylurea receptor. For this purpose, binding properties of the particulate and solubilized site from rat or pig cerebral cortex were analyzed. Maximum recovery of receptors in detergent extracts amounted to 40-50%. Specific binding of [3H]glibenclamide to the solubilized receptors corresponded well to specific binding to microsomes. In microsomes and detergent extracts, the Mg2+ complexes of ATP, ADP, GTP, and GDP inhibited binding of [3H]glibenclamide. These effects were not observed in the absence of Mg2+. In detergent extracts, Mg-ATP (300 microM) reduced the number of high-affinity sites for [3H]-glibenclamide by 52% and increased the dissociation constant for [3H]glibenclamide by eightfold; Mg-ATP was half-maximally effective at 41 microM. Alkaline phosphatase accelerated the reversal of Mg-ATP-induced inhibition of [3H]glibenclamide binding. The data suggest similar control of the sulfonylurea receptor from brain and pancreatic islets by protein phosphorylation.     

Settlement of the diazotrophic,phytoeffective bacterial strain Pantoea agglomerans on and within winter wheat: An investigation using ELISA and transmission electron microscopy

The aim of this study was to investigate the ability of Pantoea agglomerans, a plant growth-promoting bacterium, to colonize various regions and tissues of the wheat plant (Triticum aestivum L.) by using different inoculation methods and inoculum concentrations. In addition, the enzyme-linked immunosorbent assay (ELISA) and transmission electron microscopy (TEM) were used to determine: (a) the ability of the bacterial cells to grow and survive both on the surface and within internal tissue of the plant and (b) the response of the plant to bacterial infection. After inoculation, cells of the diazotrophic bacterial strain P. agglomerans were found to be located in roots, stems and leaves. Colony development of bacterial cells was only detected within intercellular spaces of the root and on the root surface. However, single bacterial cells were observed in leaves and stems on the surface of the epidermis, in the vicinity to stomatal cells, within intercellular spaces of the mesophyll and within xylem vessels. Inoculated bacterial cells were found to be able to enter host tissues, to multiply in the plant and to maintain a delicate relationship between endophyte and host. The density of bacterial settlement in the plant in all experiments was about 10⁶ to 10⁷ cells per mL root or shoot sap. Establishment was confirmed by a low coefficient of variation of ELISA means at these concentrations.     

Patterned distribution of membrane-associated Ca2+ during pore formation inMicrasterias

Summary During the stage of pore formation developing cells ofMicrasterias denticulata show a patterned distribution of fluorescent dots on the plasma membrane after treatment with chlorotetracycline. The center-to-center spacing of these dots corresponds with the distances between the individual cell wall pores ofMicrasterias. Therefore it is supposed that the patterned distribution of pores and their formation which is mediated by special pore vesicles are related to local accumulations of membrane-associated Ca²⁺. Membrane-associated Ca²⁺ seems not only to be functional in tip growth but to be a general mediator for recognition and fusion processes between various vesicles and the plasma membrane.     

Unusual behaviour of SPO1 DNA with respect to restriction and modification enzymes recognizing the sequence 5''-G-G-C-C

Summary SPO1 DNA contains only 5 cleavage sites for restriction enzymes which recognize and cleave the sequence 5-G-G-C-C (HaeIII or BsuR). Fragments of SPO1 DNA cloned in E. coli to substitute 5-hydroxymethyluracil (HMU) by thymine (T) remain resistant to HaeIII indicating that this unexpectedly small number of cleavages by HaeIII is not correlated with the presence of HMU in the normal phage DNA. It was previously shown that SPO1 is neither subject to B. subtilis R restriction (Trautner et al., 1974) nor modification in vivo (Günthert et al., 1975). We now show that SPO1 DNA can however be restricted and modified in vitro.