Indirekte Regelmechanismen der Stoffwechselgröße von Fischen

Metabolic rate does not strictly follow changes of influencing parameters. O₂-consumption by fish is ordinarily said to be independent from O₂-pressure throughout a wide range. This constancy is probably the result of a regulation. The metabolic rate itself or an auxiliary mechanism “before” or “after” metabolism may be regulated. On the basis of vanDam's paper (1938) and our own experiments, the problem whether or not O₂-pressure in blood serves as a regulated auxiliary mechanism in order to maintain a certain metabolic constancy is discussed. The disadvantage of such a regulation would be the energy demand of increased ventilation and circulation as compensating mechanisms. In accordance with this assumption we have found a rise in O₂-consumption at a somewhat reduced O₂-pressure. Locomotory behaviour supports the constancy of metabolic rate; thus a contrary shift of the temperature preferendum after application of substances which influence metabolism has been found.     

Variation in nitrate metabolism in biovars of Pseudomonas solanacearum

A collection of 327 strains of Pseudomonas solanacearum , representing five biovars, was divisible into three groups on the basis of differences in nitrate metabolism. Nine strains (2.8%), of which seven were biovar 2 from bacterial wilt of potato, were nitrate reduction-deficient and failed to produce nitrite from nitrate by either of two methods of detection in five different media. A second group of 231 strains, comprising biovars 1 and 2 and a single biovar 3 strain, produced nitrite from nitrate and grew vigorously in the presence of nitrate under anaerobic conditions but were deficient in ability to denitrify. A third group comprising 57 strains of biovar 3, 28 of biovar 4 and one each of biovar 2 and 5 produced nitrite from nitrate and gave profuse growth and gas production from nitrate under anaerobic conditions. However, production of gas from nitrate (denitrification) was not a consistently reproducible property in some of the media tested. Gas production results were most reproducible when a semi-solid succinate/nitrate or glycerol/nitrate medium was used. Serial passage of four nitrate reduction-deficient isolates in nitrate medium did not restore ability to reduce nitrate.     

Expression of A mating type genes of Coprinus cinereus in a heterologous basidiomycete host

The A mating factor of Coprinus cinereus determines compatibility in mating by regulating part of a developmental sequence that leads to dikaryon formation. The A genes that trigger development encode two different classes of homeodomain proteins, and for a successful mating, a protein of one class, HD 1, must interact with a protein of the other class, HD 2. In this report we show that C. cinereus A genes that encode HD 2 proteins, a2-1 and b2-1, can elicit A-regulated development in the heterologous host C. bilanatus. Transformation rates were very low, suggesting that the genes were poorly transcribed. The fact that the HD 2 genes are functionally expressed implies successful heteromultimeric association of putative DNA-binding proteins coded by the two Coprinus species. This interaction was sufficient to satisfy the need for different A factors in the formation of a fertile C. bilanatus dikaryon, but fertile dikaryons were more readily produced in matings with the a2-1 gene transformants. The C. cinereus A genes, b1-1 and d1-1, which encode HD1 proteins, were either not expressed or their proteins were non-functional in C. bilanatus. These experiments raise some interesting questions regarding HD1–HD2 protein interactions.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Photooxidation reactions of diphenylcarbazide and their DCMU-sensitivity in thylakoids of the blue-green alga Oscillatoria chalybea

Thylakoids of Oscillatoria chalybea are able to split water. The Hill reaction of these thylakoids is sensitive to DCMU. Diphenylcarbazide can substitute for water as the electron donor to photosystem II with these fully functioning thylakoids. However, the diphenylcarbazide photooxidation is completely insensitive to 3-(3,4-dichlorophenyl)-N-N-dimethyl urea (DCMU) at high diphenylcarbazide concentrations. In with Tris-treated Oscillatoria thylakoids the water splitting capacity is lost and diphenylcarbazide restores electron transport through photosystem II as occurs with higher plant chloroplasts. However, also these photoreactions are insensitive to DCMU. If diphenylcarbazide acts in Oscillatoria as an electron donor to photosystem II the result suggests that diphenylcarbazide feeds in its electrons behind the DCMU inhibition site. This in turn indicates that in Oscillatoria the site of inhibition of DCMU is on the donor side of photosystem II.Abbreviations Used DCMU 3-(3,4-dichlorophenyl)-N-N-dimethyl urea - DPC diphenylcarbazide - DCPiP 2,6-dichlorophenol indophenol - TMB tetramethyl benzidine - A-2-sulf anthraquinone-2-sulfonate     

Predator-specific enrichment of actinobacteria from a cosmopolitan freshwater clade in mixed continuous culture

We investigated whether individual populations of freshwater bacteria in mixed experimental communities may exhibit specific responses to the presence of different bacterivorous protists. In two successive experiments, a two-stage continuous cultivation system was inoculated with nonaxenic batch cultures of the cryptophyte Cryptomonas sp. Algal exudates provided the sole source of organic carbon for growth of the accompanying microflora. The dynamics of several 16S rRNA-defined bacterial populations were followed in the experimental communities. Although the composition and stability of the two microbial communities differed, numerous members of the first assemblage could again be detected during the second experiment. The introduction of a size-selectively feeding mixotrophic nanoflagellate (Ochromonas sp.) always resulted in an immediate bloom of a single phylotype population of members of the class Actinobacteria (Ac1). These bacteria were phylogenetically affiliated with an uncultured lineage of gram-positive bacteria that have been found in freshwater habitats only. The Ac1 cells were close to the average size of freshwater bacterioplankton and significantly smaller than any of the other experimental community members. In contrast, no increase of the Ac1 population was observed in vessels exposed to the bacterivorous ciliate Cyclidium glaucoma. However, when the Ochromonas sp. was added after the establishment of C. glaucoma, the proportion of population Ac1 within the microbial community rapidly increased. Populations of a beta proteobacterial phylotype related to an Aquabacterium sp. decreased relative to the total bacterial communities following the addition of either predator, albeit to different extents. The community structure of pelagic microbial assemblages can therefore be influenced by the taxonomic composition of the predator community.     

The Dictyostelium discoideum family of Rho-related proteins

Taking advantage of the ongoing Dictyostelium genome sequencing project, we have assembled >73 kb of genomic DNA in 15 contigs harbouring 15 genes and one pseudogene of Rho-related proteins. Comparison with EST sequences revealed that every gene is interrupted by at least one and up to four introns. For racC extensive alternative splicing was identified. Northern blot analysis showed that mRNAs for racA, racE, racG, racH and racI were present at all stages of development, whereas racJ and racL were expressed only at late stages. Amino acid sequences have been analysed in the context of Rho-related proteins of other organisms. Rac1a/1b/1c, RacF1/F2 and to a lesser extent RacB and the GTPase domain of RacA can be grouped in the Rac subfamily. None of the additional Dictyostelium Rho-related proteins belongs to any of the well-defined subfamilies, like Rac, Cdc42 or Rho. RacD and RacA are unique in that they lack the prenylation motif characteristic of Rho proteins. RacD possesses a 50 residue C-terminal extension and RacA a 400 residue C-terminal extension that contains a proline-rich region, two BTB domains and a novel C-terminal domain. We have also identified homologues for RacA in Drosophila and mammals, thus defining a new subfamily of Rho proteins, RhoBTB.     

Structure-based functional inference in structural genomics

The dramatically increasing number of new protein sequences arising from genomics 4 proteomics requires the need for methods to rapidly and reliably infer the molecular and cellular functions of these proteins. One such approach, structural genomics, aims to delineate the total repertoire of protein folds in nature, thereby providing three-dimensional folding patterns for all proteins and to infer molecular functions of the proteins based on the combined information of structures and sequences. The goal of obtaining protein structures on a genomic scale has motivated the development of high throughput technologies and protocols for macromolecular structure determination that have begun to produce structures at a greater rate than previously possible. These new structures have revealed many unexpected functional inferences and evolutionary relationships that were hidden at the sequence level. Here, we present samples of structures determined at Berkeley Structural Genomics Center and collaborators laboratories to illustrate how structural information provides and complements sequence information to deduce the functional inferences of proteins with unknown molecular functions.Two of the major premises of structural genomics are to discover a complete repertoire of protein folds in nature and to find molecular functions of the proteins whose functions are not predicted from sequence comparison alone. To achieve these objectives on a genomic scale, new methods, protocols, and technologies need to be developed by multi-institutional collaborations worldwide. As part of this effort, the Protein Structure Initiative has been launched in the United States (PSI; www.nigms.nih.gov/funding/psi.html). Although infrastructure building and technology development are still the main focus of structural genomics programs [1–6], a considerable number of protein structures have already been produced, some of them coming directly out of semi-automated structure determination pipelines [6–10]. The Berkeley Structural Genomics Center (BSGC) has focused on the proteins of Mycoplasma or their homologues from other organisms as its structural genomics targets because of the minimal genome size of the Mycoplasmas as well as their relevance to human and animal pathogenicity (http://www.strgen.org). Here we present several protein examples encompassing a spectrum of functional inferences obtainable from their three-dimensional structures in five situations, where the inferences are new and testable, and are not predictable from protein sequence information alone.