Nucleotide changes in the translated region of SCN5A from Japanese patients with Brugada syndrome and control subjects

The mutations of the SCN5A gene have been implicated to play a pathogenetic role in Brugada syndrome, which causes ventricular fibrillation. To determine the Brugada-associated mutations in Japanese patients, facilitate pre-symptomatic diagnosis, and allow genotype-phenotype studies, we screened unrelated patients with Brugada syndrome for mutations. DNAs from 6 Japanese patients were obtained and the sequence in the translated region of SCN5A was determined. We could not find the mutations reported previously, but found 17 sites of nucleotide change, consisting of 7 synonymous and 10 non-synonymous nucleotide changes in our patients. Among them, two non-synonymous nucleotide changes (G1663A and G5227A) are specific to our patients and these changes were not found in 53 healthy controls. In 4 patients out of 6, no specific nucleotide change for Brugada syndrome could be detected. Our findings demonstrating no patient-specific change in the translated region of the SCN5A gene among two thirds of the small number of patients examined here imply that another gene other than the SCN5A may be associated with this disease, supporting previous investigations in Japan and other countries.     

Theanine,gamma-glutamylethylamide,is metabolized by renal phosphate-independent glutaminase

The distribution of theanine-degrading activity in Wistar rats was examined and this activity was detected only in the kidney. Judging from polyacrylamide gel electrophoresis, theanine-degrading enzyme from rat kidney was purified almost to homogeneity. Theanine-degrading activity was co-purified with glutaminase activity, and the relative activity for theanine was about 85% of that for L-glutamine throughout purification. Substrate specificity of purified enzyme preparation coincided well with the data of phosphate-independent glutaminase [EC 3.5.1.2], which had been previously reported. It was very curious that gamma-glutamyl methyl and ethyl esters were more effectively hydrolyzed than theanine and L-glutamine, in view of relative activity and K(m) value. It was suggested that gamma-glutamyl moiety in theanine molecule was transferred to form gamma-glutamylglycylglycine with relative ease in the presence of glycylglycine. On the other hand, purified phosphate-dependent glutaminase did not show theanine-degrading activity at all. Thus, it was concluded that theanine was hydrolyzed by phosphate-independent glutaminase in kidney and suggested that, as for the metabolic fate of theanine, its glutamyl moiety might be transferred by means of gamma-glutamyl transpeptidase reaction to other peptides in vivo.     

Loss of kindlin-1, a human homolog of the Caenorhabditis elegans actin-extracellular-matrix linker protein UNC-112, causes Kindler syndrome

Kindler syndrome is an autosomal recessive disorder characterized by neonatal blistering, sun sensitivity, atrophy, abnormal pigmentation, and fragility of the skin. Linkage and homozygosity analysis in an isolated Panamanian cohort and in additional inbred families mapped the gene to 20p12.3. Loss-of-function mutations were identified in the FLJ20116 gene (renamed “KIND1” [encoding kindlin-1]). Kindlin-1 is a human homolog of the Caenorhabditis elegans protein UNC-112, a membrane-associated structural/signaling protein that has been implicated in linking the actin cytoskeleton to the extracellular matrix (ECM). Thus, Kindler syndrome is, to our knowledge, the first skin fragility disorder caused by a defect in actin-ECM linkage, rather than keratin-ECM linkage.     

Molecular dynamics simulation of dimeric and monomeric forms of human prion protein: insight into dynamics and properties

A central theme in prion protein research is the detection of the process that underlies the conformational transition from the normal cellular prion form (PrP(C)) to its pathogenic isoform (PrP(Sc)). Although the three-dimensional structures of monomeric and dimeric human prion protein (HuPrP) have been revealed by NMR spectroscopy and x-ray crystallography, the process underlying the conformational change from PrP(C) to PrP(Sc) and the dynamics and functions of PrP(C) remain unknown. The dimeric form is thought to play an important role in the conformational transition. In this study, we performed molecular dynamics (MD) simulations on monomeric and dimeric HuPrP at 300 K and 500 K for 10 ns to investigate the differences in the properties of the monomer and the dimer from the perspective of dynamic and structural behaviors. Simulations were also undertaken with Asp178Asn and acidic pH, which is known as a disease-associated factor. Our results indicate that the dynamics of the dimer and monomer were similar (e.g., denaturation of helices and elongation of the beta-sheet). However, additional secondary structure elements formed in the dimer might result in showing the differences in dynamics and properties between the monomer and dimer (e.g., the greater retention of dimeric than monomeric tertiary structure).     

T cells of atomic bomb survivors respond poorly to stimulation by Staphylococcus aureus toxins in vitro: does this stem from their peripheral lymphocyte populations having a diminished naïve CD4 T-cell content?

We found previously that the peripheral CD4 T-cell populations of heavily exposed A-bomb survivors contained fewer na?ve T cells than we detected in the corresponding unexposed controls. To determine whether this demonstrable impairment of the CD4 T-cell immunity of A-bomb survivors was likely to affect the responsiveness of their immune systems to infection by common pathogens, we tested the T cells of 723 survivors for their ability to proliferate in vitro after a challenge by each of the Staphylococcus aureus toxins SEB, SEC-2, SEC-3, SEE and TSST-1. The results presented here reveal that the proliferative responses of T cells of A-bomb survivors became progressively weaker as the radiation dose increased and did so in a manner that correlated well with the decreasing CD45RA-positive (na?ve) [but not CD45RA-negative (memory)] CD4 T-cell percentages that we found in their peripheral blood lymphocyte (PBL) populations. We also noted that the T cells of survivors with a history of myocardial infarction tended to respond poorly to several (or even all) of the S. aureus toxins, and that these same individuals had proportionally fewer CD45RA-positive (na?ve) CD4 T cells in their PBL populations than we detected in survivors with no myocardial infarction in their history. Taken together, these results clearly indicate that A-bomb irradiation led to an impairment of the ability of exposed individuals to maintain their na?ve T-cell pools. This may explain why A-bomb survivors tend to respond poorly to toxins encoded by the common pathogenic bacterium S. aureus.     

Retardation and inhibition of the cation-induced superoxide generation in BY-2 tobacco cell suspension culture by Zn2+ and Mn2+

Salts at high concentrations may cause oxidative damage to plant cells since many studies indicated the involvement of reactive oxygen species in salt-stress response. Recently, we have demonstrated that treatment of tobacco ( Nicotiana tabacum ) cell suspension culture with various salts result in an immediate burst of superoxide production via activation of NADPH oxidase by ions of alkali metals (Li⁺, Na⁺, K⁺), alkali earth metals (Mg²⁺, Ca²⁺) or lanthanides (La³⁺, Gd³⁺). In this study, we tested the effect of extracellular supplementation of Zn²⁺ and Mn²⁺ on the cation-induced oxidative burst in tobacco cell suspension culture, measured with a superoxide-specific Cypridina luciferin-derived chemiluminescent reagent. Extracellular supplementation of Zn²⁺ and Mn²⁺ inhibited the generation of superoxide in response to addition of salts. Although both Zn²⁺ and Mn²⁺ inhibited the salt-induced generation of superoxide, the modes of inhibition by those ions seemed to be different since Mn²⁺ simply inhibited total production of superoxide while Zn²⁺ inhibited the early phase of superoxide production and induced the slow release of superoxide. Roles of Mn²⁺ and Zn²⁺ in protection of plant cells from salt stress, as an effective superoxide scavenger and an effective inhibitor of plasma membrane-bound NADPH oxidase, respectively, are discussed.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.