Variation and taxonomy of Pyxidanthera (Diapensiaceae)

Brittonia - Morphological and ecological studies of seven populations ofPyxidanthera barbulata Michx. in North and South Carolina indicate that the variation among populations is clinal and...     

A family-based approach to preventing excessive weight gain

Objective: Preventing weight gain in adults and excessive weight gain in children is a high priority. We evaluated the ability of a family‐based program aimed at increasing steps and cereal consumption (for breakfast and snacks) to reduce weight gain in children and adults. Research Methods and Procedures: Families (n = 105) with at least one 8‐ to 12‐year‐old child who was at‐risk‐for‐overweight or overweight (designated as the target child) were recruited for the study. Eighty‐two families were randomly assigned to receive the family‐based intervention and 23 families to the control condition. The 13‐week intervention consisted of specific increases in daily steps (an additional 2000 steps/d) and consumption of 2 servings/d of ready‐to‐eat cereal. Results: The intervention was successful in increasing walking (steps) and cereal consumption. The intervention had positive, significant effects on percentage BMI‐for‐age and percentage body fat for target children and weight, BMI, and percentage body fat for parents. On further analysis, the positive effects of the intervention were seen largely in target girls and moms, rather than in target boys and dads. Discussion: This family‐based weight gain prevention program based on small changes holds promise for reducing excessive weight gain in families and especially in growing overweight children.     

Genetics of lipid deposition in the Japanese quail

Summary The research presented here was designed to investigate the mode of inheritance of fat and lean tissue deposition, and the relationship between them and body weight in Japanese quail. Heterotic effects were found for weight, size, and number of adipocytes in the abdominal fat depots, weight of the sartorial fat depot and percentage carcass fat with means for the hybrids being lower than those for the parental lines. General inferences concerning the importance of nonadditive genetic variation for lean and body weight were precluded due to inconsistencies observed among mating combinations. Thus, although heterosis and recombination effects were general for characteristics associated with fat deposition, the situation for body weight and lean was unique to the populations involved. It may be hypothesized that heterosis in the efficiency of feed utilization is reflected by the heterosis for fat deposition which explains why hybrids utilize feed better than their parental lines.     

Reduction of simian-human immunodeficiency virus 89.6P viremia in rhesus monkeys by recombinant modified vaccinia virus Ankara vaccination

Since cytotoxic T lymphocytes (CTLs) are critical for controlling human immunodeficiency virus type 1 (HIV-1) replication in infected individuals, candidate HIV-1 vaccines should elicit virus-specific CTL responses. In this report, we study the immune responses elicited in rhesus monkeys by a recombinant poxvirus vaccine and the degree of protection afforded against a pathogenic simian-human immunodeficiency virus SHIV-89.6P challenge. Immunization with recombinant modified vaccinia virus Ankara (MVA) vectors expressing SIVmac239 gag-pol and HIV-1 89.6 env elicited potent Gag-specific CTL responses but no detectable SHIV-specific neutralizing antibody (NAb) responses. Following intravenous SHIV-89.6P challenge, sham-vaccinated monkeys developed low-frequency CTL responses, low-titer NAb responses, rapid loss of CD4+ T lymphocytes, high-setpoint viral RNA levels, and significant clinical disease progression and death in half of the animals by day 168 postchallenge. In contrast, the recombinant MVA-vaccinated monkeys demonstrated high-frequency secondary CTL responses, high-titer secondary SHIV-89.6-specific NAb responses, rapid emergence of SHIV-89.6P-specific NAb responses, partial preservation of CD4+ T lymphocytes, reduced setpoint viral RNA levels, and no evidence of clinical disease or mortality by day 168 postchallenge. There was a statistically significant correlation between levels of vaccine-elicited CTL responses prior to challenge and the control of viremia following challenge. These results demonstrate that immune responses elicited by live recombinant vectors, although unable to provide sterilizing immunity, can control viremia and prevent disease progression following a highly pathogenic AIDS virus challenge.     

Distribution, Ecology and Population Dynamics of the American Burying Beetle [Nicrophorus Americanus Olivier (Coleoptera, Silphidae)] in South-central Nebraska, USA

The endangered American burying beetle, Nicrophorus americanus Olivier, was previously widespread throughout eastern North America. In the past century numbers of this beetle have drastically declined and currently remnant populations are known from only six states despite intensive surveying efforts conducted for the last nine years. Efforts aimed at discovering and managing remnant populations have been generally limited by a lack of knowledge concerning N. americanus biology. We used baited pitfall traps to define the range of the Gothenburg, Nebraska population of N. americanus. Using mark-recapture techniques, we estimate that the annual Gothenburg population consists of more than one thousand individuals, meeting the recovery plan criterion to become the third breeding population in the Midwest region. Beyond estimates of population size and range, we present novel data on seasonal and daily activity, sex ratio, age-grading and foraging distances. In 1995 and 1996, the Nebraska population was univoltine and female biased, with over-wintering mature beetles emerging in early June and teneral beetles emerging in August. Nocturnal activity was highest in the third and fourth hours following sunset but was not strongly correlated with temperature. During foraging, beetles travel up to six kilometers, but the majority of our recaptures occurred at distances of less than 0.5 km, suggesting that distances between traps be increased to ensure independence of sampling units. This information will allow future work on captive breeding, re-introduction and genetic studies.     

Peripheral metabolic responses to prolonged weight reduction that promote rapid, efficient regain in obesity-prone rats

Weight regain after weight loss is the most significant impediment to long-term weight reduction. We have developed a rodent paradigm that models the process of regain after weight loss, and we have employed both prospective and cross-sectional analyses to characterize the compensatory adaptations to weight reduction that may contribute to the propensity to regain lost weight. Obese rats were fed an energy-restricted (50-60% kcal) low-fat diet that reduced body weight by 14%. This reduced weight was maintained for up to 16 wk with limited provisions of the low-fat diet. Intake restriction was then removed, and the rats were followed for 56 days as they relapsed to the obese state. Prolonged weight reduction was accompanied by 1) a persistent energy gap resulting from an increased drive to eat and a reduced expenditure of energy, 2) a higher caloric efficiency of regain that may be linked with suppressed lipid utilization early in the relapse process, 3) preferential lipid accumulation in adipose tissue accompanied by adipocyte hyperplasia, and 4) humoral adiposity signals that underestimate the level of peripheral adiposity and likely influence the neural pathways controlling energy balance. Taken together, long-term weight reduction in this rodent paradigm is accompanied by a number of interrelated compensatory adjustments in the periphery that work together to promote rapid and efficient weight regain. These metabolic adjustments to weight reduction are discussed in the context of a homeostatic feedback system that controls body weight.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

The PPAR-alpha activator fenofibrate fails to provide myocardial protection in ischemia and reperfusion in pigs

Rodent studies suggest that peroxisome proliferator-activated receptor-alpha (PPAR-alpha) activation reduces myocardial ischemia-reperfusion (I/R) injury and infarct size; however, effects of PPAR-alpha activation in large animal models of myocardial I/R are unknown. We determined whether chronic treatment with the PPAR-alpha activator fenofibrate affects myocardial I/R injury in pigs. Domestic farm pigs were assigned to treatment with fenofibrate 50 mg.kg(-1).day(-1) orally or no drug treatment, and either a low-fat (4% by weight) or a high-fat (20% by weight) diet. After 4 wk, 66 pigs underwent 90 min low-flow regional myocardial ischemia and 120 min reperfusion under anesthetized open-chest conditions, resulting in myocardial stunning. The high-fat group received an infusion of triglyceride emulsion and heparin during this terminal experiment to maintain elevated arterial free fatty acid (FFA) levels. An additional 21 pigs underwent 60 min no-flow ischemia and 180 min reperfusion, resulting in myocardial infarction. Plasma concentration of fenofibric acid was similar to the EC50 for activation of PPAR-alpha in vitro and to maximal concentrations achieved in clinical use. Myocardial expression of PPAR-alpha mRNA was prominent but unaffected by fenofibrate treatment. Fenofibrate increased expression of carnitine palmitoyltransferase (CPT)-I mRNA in liver and decreased arterial FFA and lactate concentrations (each P < 0.01). However, fenofibrate did not affect myocardial CPT-I expression, substrate uptake, lipid accumulation, or contractile function during low-flow I/R in either the low- or high-fat group, nor did it affect myocardial infarct size. Despite expression of PPAR-alpha in porcine myocardium and effects of fenofibrate on systemic metabolism, treatment with this PPAR-alpha activator does not alter myocardial metabolic or contractile responses to I/R in pigs.     

Key features determining the specificity of aspartic proteinase inhibition by the helix-forming IA3 polypeptide

The 68-residue IA(3) polypeptide from Saccharomyces cerevisiae is essentially unstructured. It inhibits its target aspartic proteinase through an unprecedented mechanism whereby residues 2-32 of the polypeptide adopt an amphipathic alpha-helical conformation upon contact with the active site of the enzyme. This potent inhibitor (K(i) < 0.1 nm) appears to be specific for a single target proteinase, saccharopepsin. Mutagenesis of IA(3) from S. cerevisiae and its ortholog from Saccharomyces castellii was coupled with quantitation of the interaction for each mutant polypeptide with saccharopepsin and closely related aspartic proteinases from Pichia pastoris and Aspergillus fumigatus. This identified the charged K18/D22 residues on the otherwise hydrophobic face of the amphipathic helix as key selectivity-determining residues within the inhibitor and implicated certain residues within saccharopepsin as being potentially crucial. Mutation of these amino acids established Ala-213 as the dominant specificity-governing feature in the proteinase. The side chain of Ala-213 in conjunction with valine 26 of the inhibitor marshals Tyr-189 of the enzyme precisely into a position in which its side-chain hydroxyl is interconnected via a series of water-mediated contacts to the key K18/D22 residues of the inhibitor. This extensive hydrogen bond network also connects K18/D22 directly to the catalytic Asp-32 and Tyr-75 residues of the enzyme, thus deadlocking the inhibitor in position. In most other aspartic proteinases, the amino acid at position 213 is a larger hydrophobic residue that prohibits this precise juxtaposition of residues and eliminates these enzymes as targets of IA(3). The exquisite specificity exhibited by this inhibitor in its interaction with its cognate folding partner proteinase can thus be readily explained.     

Low-dose radiation exposure and atherosclerosis in ApoE⁻/⁻ mice

The hypothesis that single low-dose exposures (0.025-0.5 Gy) to low-LET radiation given at either high (about 150 mGy/min) or low (1 mGy/min) dose rate would promote aortic atherosclerosis was tested in female C57BL/6J mice genetically predisposed to this disease (ApoE?/?). Mice were exposed either at an early stage of disease (2 months of age) and examined 3 or 6 months later or at a late stage of disease (8 months of age) and examined 2 or 4 months later. Changes in aortic lesion frequency, size and severity as well as total serum cholesterol levels and the uptake of lesion lipids by lesion-associated macrophages were assessed. Statistically significant changes in each of these measures were observed, depending on dose, dose rate and disease stage. In all cases, the results were distinctly non-linear with dose, with maximum effects tending to occur at 25 or 50 mGy. In general, low doses given at low dose rate during either early- or late-stage disease were protective, slowing the progression of the disease by one or more of these measures. Most effects appeared and persisted for months after the single exposures, but some were ultimately transitory. In contrast to exposure at low dose rate, high-dose-rate exposure during early-stage disease produced both protective and detrimental effects, suggesting that low doses may influence this disease by more than one mechanism and that dose rate is an important parameter. These results contrast with the known, generally detrimental effects of high doses on the progression of this disease in the same mice and in humans, suggesting that a linear extrapolation of the known increased risk from high doses to low doses is not appropriate.