Estimating Mammalian Abundance Using Camera Traps in the Tropical Forest of Similipal Tiger Reserve,Odisha, India

Knowledge on the occurrence and distribution of species is crucial for designing and evaluating conservation strategies within a geographical region. Similipal Tiger Reserve though confined to a small area needs information on the diversity and abundance of mammalian fauna to ensure conservation of tiger. Thus, we aimed to assess the diversity and abundance of medium to large sized mammals in Similipal Tiger Reserve by using remotely triggered camera traps. A total of 6413 camera trap days at 187 trap stations were deployed from November 2012 to July 2013 to estimate the status of mammal. We obtained 3763 independent photographs and detected 24 species of mammals. The relative abundance index of each mammalian species was calculated. Leopard (Panthera pardus) was the most abundant carnivore while barking deer (Muntiacus muntjac) was the most abundant prey. Anthropogenic activities like hunting, livestock grazing and free ranging domestic dogs were found to be the detrimental factors for the existing mammalian species. These activities should be addressed through conservation and development perception with an interdisciplinary approach, incorporating social and ecological components cautiously.     

Molecular Weights of Vesicular Stomatitis Virus and Its Defective Particles by Laser Light-Scattering Spectroscopy

Laser light-scattering spectroscopy has been used to determine the diffusion coefficients of vesicular stomatitis virus and three of its defective particles in order to calculate their molecular weights.     

Occurrence of nitrogen-fixing Azospirillum in vesicular-arbuscular mycorrhizal fungi

Nitrogenase activity measured by acetylene reduction, was detected when surface-sterilized spores of vesicular-arbuscular (VA) mycorrhizal fungi (Glomus fasciculatum, G. intraradices, G. scientillans, G. mosseae, Gigaspora gilmorei andEndogone dusii) were inoculated into nitrogen-free liquid medium containing malic acid and incubated under microaerophilic conditions (99% N₂+1% O₂) at 30°C.Azospirillum species were isolated from the nitrogenase-active cultures.     

Ansamitocin P3 Depolymerizes Microtubules and Induces Apoptosis by Binding to Tubulin at the Vinblastine Site

Maytansinoid conjugates are currently under different phases of clinical trials and have been showing promising activity for various types of cancers. In this study, we have elucidated the mechanism of action of ansamitocin P3, a structural analogue of maytansine for its anticancer activity. Ansamitocin P3 potently inhibited the proliferation of MCF-7, HeLa, EMT-6/AR1 and MDA-MB-231 cells in culture with a half-maximal inhibitory concentration of 20±3, 50±0.5, 140±17, and 150±1.1 pM, respectively. Ansamitocin P3 strongly depolymerized both interphase and mitotic microtubules and perturbed chromosome segregation at its proliferation inhibitory concentration range. Treatment of ansamitocin P3 activated spindle checkpoint surveillance proteins, Mad2 and BubR1 and blocked the cells in mitotic phase of the cell cycle. Subsequently, cells underwent apoptosis via p53 mediated apoptotic pathway. Further, ansamitocin P3 was found to bind to purified tubulin in vitro with a dissociation constant (K_d) of 1.3±0.7 µM. The binding of ansamitocin P3 induced conformational changes in tubulin. A docking analysis suggested that ansamitocin P3 may bind partially to vinblastine binding site on tubulin in two different positions. The analysis indicated that the binding of ansamitocin P3 to tubulin is stabilized by hydrogen bonds. In addition, weak interactions such as halogen-oxygen interactions may also contribute to the binding of ansamitocin P3 to tubulin. The study provided a significant insight in understanding the antiproliferative mechanism of action of ansamitocin P3.     

The first draft of the pigeonpea genome sequence

Pigeonpea (Cajanus cajan) is an important grain legume of the Indian subcontinent, South-East Asia and East Africa. More than eighty five percent of the world pigeonpea is produced and consumed in India where it is a key crop for food and nutritional security of the people. Here we present the first draft of the genome sequence of a popular pigeonpea variety ??Asha??. The genome was assembled using long sequence reads of 454 GS-FLX sequencing chemistry with mean read lengths of >550?bp and >10-fold genome coverage, resulting in 510,809,477?bp of high quality sequence. Total 47,004 protein coding genes and 12,511 transposable elements related genes were predicted. We identified 1,213 disease resistance/defense response genes and 152 abiotic stress tolerance genes in the pigeonpea genome that make it a hardy crop. In comparison to soybean, pigeonpea has relatively fewer number of genes for lipid biosynthesis and larger number of genes for cellulose synthesis. The sequence contigs were arranged in to 59,681 scaffolds, which were anchored to eleven chromosomes of pigeonpea with 347 genic-SNP markers of an intra-species reference genetic map. Eleven pigeonpea chromosomes showed low but significant synteny with the twenty chromosomes of soybean. The genome sequence was used to identify large number of hypervariable ??Arhar?? simple sequence repeat (HASSR) markers, 437 of which were experimentally validated for PCR amplification and high rate of polymorphism among pigeonpea varieties. These markers will be useful for fingerprinting and diversity analysis of pigeonpea germplasm and molecular breeding applications. This is the first plant genome sequence completed entirely through a network of Indian institutions led by the Indian Council of Agricultural Research and provides a valuable resource for the pigeonpea variety improvement.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

The evolutionary radiation of Arvicolinae rodents (voles and lemmings): relative contribution of nuclear and mitochondrial DNA phylogenies

Background  

Mitochondrial and nuclear genes have generally been employed for different purposes in molecular systematics, the former to resolve relationships within recently evolved groups and the latter to investigate phylogenies at a deeper level. In the case of rapid and recent evolutionary radiations, mitochondrial genes like cytochrome b (CYB) are often inefficient for resolving phylogenetic relationships. One of the best examples is illustrated by Arvicolinae rodents (Rodentia; Muridae), the most impressive mammalian radiation of the Northern Hemisphere which produced voles, lemmings and muskrats. Here, we compare the relative contribution of a nuclear marker – the exon 10 of the growth hormone receptor (GHR) gene – to the one of the mitochondrial CYB for inferring phylogenetic relationships among the major lineages of arvicoline rodents.     

Toxicity of carbaryl and 1-naphthol to four species of freshwater fish

The toxicity of the carbamate insecticide carbaryl (Seven√) and its metabolite, 1-naphthol, to four species of fish was studied. The calculated 96 h LC 60 values of carbaryl forCatla catla (Ham.), Anabas testudineus (Bloch),Mystus cavasius (Ham.) andMystus vittatus (Bloch) are 6.4, 6.6, 4.6 and 2.4 ppm respectively and that of 1-naphthol are 4.3,3, 0.33 and 1.1 ppm respectively. The degradation product of the insecticide was found to be more toxic than the parent compound, to all the four species studied.     

Genotypes of Echinococcus Species from Cattle in Tanzania

Cystic echinococcosis is a zoonotic parasitic disease caused by Echinococcus species. Tanzania is one of the endemic countries with cystic echinococcosis. This study focussed on identifying genotypes of Echinococcus spp. in Tanzania. We collected 7 cysts from cattle in Mwanza municipal (n=4) and Loliondo district (n=3). The cysts from Mwanza were all E. ortleppi and fertile. In contrast, the cysts from Loliondo were all E. granulosus sensu stricto and sterile. Two from the 4 cysts were a new haplotype of E. ortleppi (G5). These results can improve the preventive and control programs for humans and livestock in Tanzania. To our knowledge, this study is considered the first to identify the genotype and haplotype of Echinococcus spp. in Tanzania.