The first draft of the pigeonpea genome sequence

Pigeonpea (Cajanus cajan) is an important grain legume of the Indian subcontinent, South-East Asia and East Africa. More than eighty five percent of the world pigeonpea is produced and consumed in India where it is a key crop for food and nutritional security of the people. Here we present the first draft of the genome sequence of a popular pigeonpea variety ??Asha??. The genome was assembled using long sequence reads of 454 GS-FLX sequencing chemistry with mean read lengths of >550?bp and >10-fold genome coverage, resulting in 510,809,477?bp of high quality sequence. Total 47,004 protein coding genes and 12,511 transposable elements related genes were predicted. We identified 1,213 disease resistance/defense response genes and 152 abiotic stress tolerance genes in the pigeonpea genome that make it a hardy crop. In comparison to soybean, pigeonpea has relatively fewer number of genes for lipid biosynthesis and larger number of genes for cellulose synthesis. The sequence contigs were arranged in to 59,681 scaffolds, which were anchored to eleven chromosomes of pigeonpea with 347 genic-SNP markers of an intra-species reference genetic map. Eleven pigeonpea chromosomes showed low but significant synteny with the twenty chromosomes of soybean. The genome sequence was used to identify large number of hypervariable ??Arhar?? simple sequence repeat (HASSR) markers, 437 of which were experimentally validated for PCR amplification and high rate of polymorphism among pigeonpea varieties. These markers will be useful for fingerprinting and diversity analysis of pigeonpea germplasm and molecular breeding applications. This is the first plant genome sequence completed entirely through a network of Indian institutions led by the Indian Council of Agricultural Research and provides a valuable resource for the pigeonpea variety improvement.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

The evolutionary radiation of Arvicolinae rodents (voles and lemmings): relative contribution of nuclear and mitochondrial DNA phylogenies

Background  

Mitochondrial and nuclear genes have generally been employed for different purposes in molecular systematics, the former to resolve relationships within recently evolved groups and the latter to investigate phylogenies at a deeper level. In the case of rapid and recent evolutionary radiations, mitochondrial genes like cytochrome b (CYB) are often inefficient for resolving phylogenetic relationships. One of the best examples is illustrated by Arvicolinae rodents (Rodentia; Muridae), the most impressive mammalian radiation of the Northern Hemisphere which produced voles, lemmings and muskrats. Here, we compare the relative contribution of a nuclear marker – the exon 10 of the growth hormone receptor (GHR) gene – to the one of the mitochondrial CYB for inferring phylogenetic relationships among the major lineages of arvicoline rodents.     

Flora Europaea Notulae Systematicae ad Floram Europaeam spectantes No. 20 Corrigenda et Addenda

Following the publication of the last of the series of Flora Europaea Notulae, No. 20 in the Botanical Journal of the Linnean Society , 76: 297–384 (1978), a number of additions or alterations have been drawn to our attention. These are published in continuation.     

Toxicity of carbaryl and 1-naphthol to four species of freshwater fish

The toxicity of the carbamate insecticide carbaryl (Seven√) and its metabolite, 1-naphthol, to four species of fish was studied. The calculated 96 h LC 60 values of carbaryl forCatla catla (Ham.), Anabas testudineus (Bloch),Mystus cavasius (Ham.) andMystus vittatus (Bloch) are 6.4, 6.6, 4.6 and 2.4 ppm respectively and that of 1-naphthol are 4.3,3, 0.33 and 1.1 ppm respectively. The degradation product of the insecticide was found to be more toxic than the parent compound, to all the four species studied.     

Genotypes of Echinococcus Species from Cattle in Tanzania

Cystic echinococcosis is a zoonotic parasitic disease caused by Echinococcus species. Tanzania is one of the endemic countries with cystic echinococcosis. This study focussed on identifying genotypes of Echinococcus spp. in Tanzania. We collected 7 cysts from cattle in Mwanza municipal (n=4) and Loliondo district (n=3). The cysts from Mwanza were all E. ortleppi and fertile. In contrast, the cysts from Loliondo were all E. granulosus sensu stricto and sterile. Two from the 4 cysts were a new haplotype of E. ortleppi (G5). These results can improve the preventive and control programs for humans and livestock in Tanzania. To our knowledge, this study is considered the first to identify the genotype and haplotype of Echinococcus spp. in Tanzania.     

Effects of symbiosis with Frankia and arbuscular mycorrhizal fungus on the natural abundance of 15N in four species of Casuarina

The effect of interactions between Casuarina species, Frankia strains and AMF on nitrogen isotope fractionation within the plant were determined under conditions where changes in source nitrogen were minimized by growing plants in mineral nitrogen-deficient conditions and without added organic N. Casuarina cunninghamiana, C. equisetifolia, C. glauca, and C. junghuniana were inoculated singly with three Frankia strains or were dual inoculated with Frankia and Glomus fasciculatum. The %N and delta 15N of separated parts of plants inoculated with the three Frankia strains or with Frankia + Glomus were not significantly different within Casuarina species. However, the slow-growing C. junghuniana differed in several variables from the other three species. There was a highly significant, linear relationship between the natural logarithms of cladode N content and delta 15N of plants of the four Casuarina species when inoculated with Frankia or with Frankia + Glomus, showing that nitrogen supply and the correlated variable, plant growth rate, were major determinants of delta 15N. Provision of small quantities of (NH4)2SO4 or KNO3 increased several-fold the growth of three of the Casuarina species when inoculated with Frankia alone or with Frankia + Glomus. Within species, mycorrhizal and non-mycorrhizal plants receiving supplementary soluble phosphate were of similar dry weights at harvest. delta 15N values for cladodes of C. cunninghamiana, C. equisetifolia and C. glauca were similar, but values for the poor growing C. junghuniana were more variable and, with the exception of plants receiving KNO3, were lower than those of the other three species. Reduced growth due to suboptimal availability of N or P had a major influence on delta 15N and, in these conditions where plants could not access significant amounts of organic N, outweighed any effects on cladode delta 15N of colonization by Glomus. delta 15N values of nodules were higher than other parts of Frankia or Frankia + Glomus inoculated Casuarinas, conceivably due to retention in nodules of fixed N, with delta 15N close to zero.