A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

The use of a bacteriophage cocktail as a biocontrol measure to reduce Salmonella enterica serovar Enteritidis contamination in ground meat and goat cheese

We evaluated the effectiveness of phages on meats and goat cheese contaminated with Salmonella Enteritidis (SE). In meats, reductions of SE were observed during the whole experiment, while in goat cheese a reduction was only observed at day 3. We discuss the relevance of phages as a biocontrol in food.     

Reducing HIV Risk among Transgender Women in Thailand: A Quasi-Experimental Evaluation of the Sisters Program

Transgender women are particularly at risk of HIV infection, but little evidence exists on effective HIV prevention strategies with this population. We evaluated whether Sisters, a peer-led program for transgender women, could reduce HIV risks in Pattaya, Thailand. The study used time-location sampling to recruit 308 transgender women in Pattaya into a behavioral survey in 2011. Coarsened exact matching was used to create statistically equivalent groups of program participants and non-participants, based on factors influencing likelihood of program participation. Using multivariable logistic regression, we estimated effects of any program participation and participation by delivery channel on: condom use at last sex; consistent condom and condom/water-based lubricant use in the past 3 months with commercial, casual, and regular partners; and receipt of HIV testing in the past 6 months. Program coverage reached 75% of the population. In a matched sub-sample (n = 238), participation in outreach was associated with consistent condom/water-based lubricant use with commercial partners (AOR 3.22, 95% CI 1.64–6.31). Attendance at the Sisters drop-in center was associated with receiving an HIV test (AOR 2.58, 95% CI 1.47–4.52). Dedicated transgender-friendly programs are effective at reducing HIV risks and require expansion to better serve this key population and improve HIV prevention strategies.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Co-fermentation of xylose and cellobiose by an engineered Saccharomyces cerevisiae

We have integrated and coordinately expressed in Saccharomyces cerevisiae a xylose isomerase and cellobiose phosphorylase from Ruminococcus flavefaciens that enables fermentation of glucose, xylose, and cellobiose under completely anaerobic conditions. The native xylose isomerase was active in cell-free extracts from yeast transformants containing a single integrated copy of the gene. We improved the activity of the enzyme and its affinity for xylose by modifications to the 5′-end of the gene, site-directed mutagenesis, and codon optimization. The improved enzyme, designated RfCO*, demonstrated a 4.8-fold increase in activity compared to the native xylose isomerase, with a K_m for xylose of 66.7?mM and a specific activity of 1.41?μmol/min/mg. In comparison, the native xylose isomerase was found to have a K_m for xylose of 117.1?mM and a specific activity of 0.29?μmol/min/mg. The coordinate over-expression of RfCO* along with cellobiose phosphorylase, cellobiose transporters, the endogenous genes GAL2 and XKS1, and disruption of the native PHO13 and GRE3 genes allowed the fermentation of glucose, xylose, and cellobiose under completely anaerobic conditions. Interestingly, this strain was unable to utilize xylose or cellobiose as a sole carbon source for growth under anaerobic conditions, thus minimizing yield loss to biomass formation and maximizing ethanol yield during their fermentation.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.