Endothelial microvilli in the vessels of the rat gasserian ganglion and testis

Summary In the Gasserian ganglion and testis of the rat the endothelium of the small blood vessels has a singular appearance due to the presence of a high number of microvillous processes. These arise from the luminal surface, either individually, or in small groups. The significance of this structure is not known. It is pointed out that these vessels are particularly sensitive to cadmium intoxication.This investigation was performed during a tenure by Dr. Gabbiani of a fellowship of the Medical Research Council of Canada and was supported by the National Institutes of Health (Grant No. 5R01 HE-08794-04) and the Ministère de la Santé du Québec (projet 604-7-635).The authors wish to thank Dr. S. M. Shea for his advice in the measurement of the villi. The technical assistance of Miss Virginia Gilmore and of Mr. Eduardo Garriga is gratefully acknowledged.     

The major 45-kDa protein of the yeast mitochondrial outer membrane is not essential for cell growth or mitochondrial function

As part of an analysis of the function and assembly of the mitochondrial outer membrane, we have cloned and characterized the yeast gene encoding a 45-kDa polypeptide (OM45) which is a major constituent of this membrane. The nuclear gene was isolated by immunological screening of plaques of recombinant phage lambda gt11 containing fragments of yeast genomic DNA using an antibody against OM45. Determination of the nucleotide sequence of the DNA fragment isolated by this approach revealed a single open reading frame of 1179 base pairs which encodes a protein having a predicted molecular mass of 44.6-kDa. Disruption of the OM45 gene in haploid yeast cells eliminated the expression of OM45. The mutant strain showed no apparent defect in cell viability, growth, mitochondrial function, or mitochondrial protein import.     

Metabolism of leukotriene B4 by guinea pig eosinophils

The metabolism of leukotriene B₄ (5(S),12(R)-dihydroxy-6-cis-8,10-trans-14-cis-eicosatetraenoic acid) by isolated guinea pig eosinophils was investigated. Incubation of guinea pig eosinophils with [³H]-leukotriene B₄ resulted in the rapid conversion of leukotriene B₄ to several more polar metabolites. Two of these metabolites were identified by ultraviolet spectroscopy and gas chromatography-mass spectrometry as the omega oxidation products 5(S),12(R),20-trihydroxy-6,8,10,14-eicosatetraenoic acid (20-hydroxy-leukotriene B₄) and 5(S),12(R),19-trihydroxy-6,8,10,14-eicosatetraenoic acid (19-hydroxy-leukotriene B₄). Two novel metabolites, 5(S),12(R),18,19-tetrahydroxy-6,8,10,14 eicosatetraenoic acid (18,19-dihydroxy-leukotriene B₄) and 5(S),12(R)-dihydroxy-1,18-dicarboxylic-6,8,10,14,16-octadecapentaenoic acid (Δ16,17–18-carboxy-19,20-dinor-leukotriene B₄) were tentatively identified. The identification of these compounds indicates that guinea pig eosinophils are capable of metabolizing leukotriene B₄ by both omega and beta oxidation. This catabolic activity may play a role in modulating inflammatory reactions by removing the chemoattractant leukotriene B₄ from inflammatory sites.     

Cytochrome P-450 and glutathione: what is the significance of their interrelationship in lipid peroxidation?

Both cytochrome P-450 and glutathione participate in the metabolism of xenobiotics. Their interrelationship is described here, as well as current findings indicating their mutual involvement in lipid peroxidation.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

R-factor-mediated suppression of the galactose-sensitive phenotype of Escherichia coli K-12 galE mutants

Plasmids S-a and Rts1 suppress the galactose-sensitive phenotype of galE mutants of Escherichia coli K-12, giving rise to both galactose-fermenting and nonfermenting strains. Fermenting strains produce normal inducible UDP-galactose epimerase. Plasmids extracted from either a fermenting or a nonfermenting strain are indistinguishable when examined by either measurements of length of relaxed circular molecules by electron microscopy or electrophoretic pattern of restriction endonuclease digestion products. The phenomenon could be explained by reversible recombination between a plasmid-borne epimerase gene and homologous chromosomal sequences.     

Steroid modulation of oxytocin/vasopressin receptors in the uterus

Oxytocin (OT) and V1 vasopressin (VP) receptors are present simultaneously in several tissues, including the uterus. In myometrium these receptors mediate contractility, while in endometrium they mediate the release of other uterotonic substances as endothelin (ET). In rabbit myometrium, estrogens increase, while progesterone blunts neurohypophysial hormone receptors. However, the action of sex steroids on OT and V1 VP receptors differs in terms of the ED₅₀ and maximal effect. Therefore, at parturition, only OT receptors show a dramatic rise, while V1 VP receptors do not change, suggesting a major role for OT in labor. ET is a potent stimulator of uterine activity acting through specific receptors present on myometrial cells. These receptors as well as the endometrial localization of ET are modulated by sex steroids, indicating that ET might represent a paracrine regulator of uterine activity. In humans, OT but not V1 VP receptors increase as pregnancy progresses, confirming the primary relevance of OT in timing delivery.     

Alpha 6.beta 1 integrin (laminin receptor) is down-regulated by tumor necrosis factor alpha and interleukin-1 beta in human endothelial cells.

Endothelial cells from human umbilical vein (HEC) express several distinct integrin complexes that mediate the interaction with the basal membrane components. In this paper we show that treatment with tumor necrosis factor alpha (TNF alpha) down-regulates the expression of the laminin receptor alpha 6.beta 1 integrin in cultured HEC. After 48 h of treatment with TNF alpha, the level of expression of the alpha 6.beta 1 complex reached 20% of the control value. The down-regulation of the alpha 6.beta 1 integrin is caused by a decreased expression of the alpha 6 subunit, whereas the synthesis of the beta 1 subunit remains constant. Northern blot analysis shows that the decreased level of alpha 6 subunit synthesis is caused by down-regulation of alpha 6 mRNA in TNF alpha-treated HEC. TNF alpha treatment does not alter the expression of alpha 2, alpha 3, and alpha 5 integrins, also present on endothelial cell surface, thus showing that this cytokine has a selective action on distinct integrin complexes. Down-regulation of alpha 6.beta 1 correlates with pronounced reduction in adhesion of TNF alpha-treated HEC to laminin, but not to fibronectin-coated culture dishes. In addition to TNF alpha, interleukin-1 beta also decreases the expression of the alpha 6.beta 1 integrin and reduces adhesion to laminin, thus suggesting that this regulation plays an important role in inflammation.