Developmental stage-dependent response ofPilobolus crystallinus sporangiophores to gravitative and centrifugal stimulation

Gravitropic response of sporangiophores ofPilobolus crystallinus was studied by successive microscopic observation of the sporangiophores horizontally placed in the dark (red light) and by analysis of sporangiophore response to centrifugal stimulation. Negative tropism against the gravitative and also centrifugal stimulation was found only in mature sporangiophores after development of sporangium and after the resumption of elongation beneath the fully-developed subsporangial vescle, but there was no response in younger sporangiophores, implying that the gravitative perception system of the sporangiophores is dependent on their developmental stages.     

Oxygen-Dependent Fragmentation of Cellular DNA by Nitric Oxide

Although active oxygen species and related metabolites, such as nitric oxide (NO), have been postulated to play important roles in the apoptosis of various cells, a precise mechanism leading to cell death remains to be elucidated. Recently we found that the lifetime of NO depends greatly on the concentration of environmental oxygen and that NO reversibly inhibits mitochondrial respiration and ATP synthesis; the inhibitory effect is stronger at physiologically low oxygen tension than under atmospheric conditions (Arch. Biochem. Biophys. 323, 27-32, 1995). The present work describes the effects of the NO-generating agent, l-hydroxy-2-oxo-3,3-bis(2-aminoethyl)-l-triazene (NOC 18) and oxygen tension on the respiration, ATP synthesis and apoptosis of HL-60 cells. When respiration was inhibited by NOC 18, cellular ATP levels decreased significantly and DNA fragmentation was elici/ted. Both events were enhanced by decreasing oxygen tension and suppressed by adding NO-trapping agents, such as 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazo-line-1-oxyl-3-oxide (carboxy-PTIO) and oxyhemoglo-bin. The fragmentation of cellular DNA was inhibited in a dose dependent manner by herbimycin A, a tyrosine kinase inhibitor. Fragmentation of the DNA of HL-60 cells was also induced either by peroxynitrite, superoxide or hydroxyl radical by some mechanism which was diminished by lowering the oxygen tension. These results indicated that the decrease in cellular ATP and activation of tyrosine kinase might play important roles in NO-induced apoptosis particularly under physiologically low oxygen tensions.     

Synthesis and hybridization studies on two complementary nona(2''-O-methyl)ribonucleotides.

2'-O-Methyl derivatives of the common ribonucleosides except for guanosine were synthesized via the 2'-O-methylation of appropriately-protected nucleosides with CH3I in the presence of Ag2O. The 2'-O-methylguanosine derivative was prepared by the monomethylation of a 2',3'-cis-diol system with diazomethane. These derivatives were converted to protected 2'-O-methylribonucleoside 3'-phosphates and used for oligonucleotide synthesis on polymer supports. Thus, oligo(2'-O-methyl-ribonucleotides) having the sequence identical to the consensus sequence of the 5'-splice junction CAGGUAAGU and its complement were synthesized in a stepwise manner using the phosphotriester method. Thermal stabilities (Tm's) of the duplex of these 2'-O-methyl ribo-oligomers and eight related duplexes containing ribo- or deoxyribo-oligomers were examined. It was found that the 2'-O-methyl oligoribonucleotides can be utilized as an alternative to an oligoribonucleotide probe in RNA hybridizations as the hybrid formed has a high, or a higher Tm, the probe is much easier to synthesize and it is less likely to be enzymatically degraded.     

5''-Levulinyl and 2''-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.     

Mechanism of action of cysteinyl leukotrienes on glucose and lactate balance and on flow in perfused rat liver. Comparison with the effects of sympathetic nerve stimulation and noradrenaline

Rat livers were perfused at constant pressure via the portal vein with media containing 5 mM glucose, 2 mM lactate and 0.2 mM pyruvate. 1. Leukotrienes C4 and D4 enhanced glucose and lactate output and reduced perfusion flow to the same extent and with essentially identical kinetics. They both caused half-maximal alterations (area under the curve) of carbohydrate metabolism at a concentration of about 1 nM and of flow at about 5 nM. The leukotriene-C4/D4 antagonist CGP 35949 B inhibited the metabolic and hemodynamic effects of 5 nM leukotrienes C4 and D4 with the same efficiency, causing 50% inhibition at about 0.1 microM. 2. Leukotriene C4 elicited the same metabolic and hemodynamic alterations with the same kinetics as leukotriene D4 in livers from rats pretreated with the gamma-glutamyltransferase inhibitor, acivicin. 3. The calcium antagonist, nifedipine, at a concentration of 50 microM did not affect the metabolic and hemodynamic changes caused by 5 nM leukotriene D4. The smooth-muscle relaxant, nitroprussiate, at a concentration of 10 microM reduced flow changes, without significantly affecting the metabolic alterations. 4. Leukotriene D4 not only reduced flow; it also caused an intrahepatic redistribution of flow, restricting some areas from perfusion. Thus, leukotrienes increased glucose and lactate output directly in the accessible parenchyma and, in addition, indirectly by washout from restricted areas during their reopening upon termination of application. 5. The phospholipase A2 inhibitor, bromophenacyl bromide, but not the cyclooxygenase inhibitor, indomethacin, at a concentration of 20 microM reduced the metabolic and hemodynamic effects of 5 mM leukotriene D4. 6. Stimulation of the sympathetic hepatic nerves with 2-ms rectangular pulses at 20 Hz and infusion of 1 microM noradrenaline increased glucose and lactate output and decreased flow, similar to 10 nM leukotrienes C4 and D4. The kinetics of the metabolic and hemodynamic changes caused by the leukotrienes differed, however, from those due to nerve stimulation and noradrenaline. 7. The leukotriene-C4/D4 antagonist, CGP 35949 B, even at very high concentrations (20 microM) inhibited the metabolic and hemodynamic alterations caused by nerve stimulation or noradrenaline infusion only slightly and unspecifically.(ABSTRACT TRUNCATED AT 400 WORDS)     

Regulation of Fc gamma receptor expression and phagocytosis of a human monoblast cell line U937. Participation of cAMP and protein kinase C in the effects of IFN-gamma and phorbol ester

We investigated the positive and negative effects of IFN-gamma, PMA, dibutyryl cAMP (Bt2cAMP), dexamethasone and transforming growth factor-beta (TGF-beta) on Fc gamma R subtype expression and phagocytosis of a human monoblast cell line, U937. IFN-gamma increased and Bt2cAMP decreased Fc gamma RI expression determined by a mAb 32.2, whereas PMA and Bt2cAMP increased Fc gamma RII expression determined by a mAb IV-3. Phagocytosis was measured microscopically by counting ingested aggregated human IgG- or BSA-treated ox E (Eo'-IgG or Eo'-BSA). IFN-gamma increased the phagocytosis of Eo'-IgG but not that of Eo'-BSA, and PMA increased the phagocytosis of both Eo'-IgG and Eo'-BSA. Bt2cAMP decreased both basal and IFN-gamma- and PMA-augmented phagocytosis of U937 cells. Dexamethasone also inhibited both basal and IFN-gamma-augmented Fc gamma RI expression and PMA-augmented Fc gamma RII expression and phagocytosis, but did not affect IFN-gamma-augmented phagocytosis of Eo'-IgG. The augmentation of phagocytosis of Eo'-IgG by IFN-gamma thus seems to be due mainly to the increased internalizing process rather than to increased Fc gamma RI expression. TGF-beta slightly decreased Fc gamma R expression. In a study of the participation of protein kinase C (PK-C), it was found that H-7, a PK-C inhibitor, did not inhibit either IFN-gamma- or PMA-enhanced Fc gamma RI and Fc gamma RII expression, respectively, and 1-oleoyl-2-acetylglycerol and N-(6-phenylhexyl)-5-chloro-1-naphthalenesulfonamide, both PK-C activators, did not show any apparent increase in Fc gamma R expression and phagocytosis. These results show that Fc gamma RI and Fc gamma RII expression on U937 cells is regulated by different mechanisms and that IFN-gamma and PMA play their roles in Fc gamma R expression and phagocytosis by different pathways. It is possible that cAMP but not PK-C plays an important role in the regulation of Fc gamma R expression and phagocytosis.     

Observations on the valve structure of marine species of the diatom genus Cocconeis Ehr.

The valve structure of three marine diatom species, Cocconeis molesta var. crucifera, C. dirupta and C. pellucida was studied by transmission and scanning electron microscopy. In all Cocconeis examined, the areolae are occluded by hymenes located near the internal openings in the raphid valve and near the internal openings in the araphid valves.     

Preparation of a verifiable peptide-protein immunogen: direction-controlled conjugation of a synthetic fragment of the monitor peptide with myoglobin and application for sequence analysis

A useful method for preparing a synthetic peptide-carrying protein for specific antibody production was established. The monitor peptide is a trypsin-sensitive cholecystokinin-releasing peptide purified from rat pancreatic juice on the basis of its stimulatory activity toward pancreatic enzyme secretion. The NH2-terminus fragment of the monitor peptide (residues 1-14) was synthesized by a solid phase method. Cysteine at the COOH terminus of the fragment was conjugated with amino groups of myoglobin using a hetero-bifunctional reagent. Sequence analysis of the fragment-myoglobin conjugate indicated that the peptide/myoglobin conjugation ratio was about 1/1 (mol/mol). Antiserum against the conjugate from a rabbit effectively abolished the stimulatory activity of the monitor peptide in the rat small intestine.     

Immunocytochemical investigation of hepatitis B virus-associated antigens in cases of liver cirrhosis and HBsAg antigenemia and their relationship to development of hepatocellular carcinoma

Summary Using light and ultrastructural immunoperoxidase techniques, we examined the distribution of hepatitis B virus (HBV)-associated antigens and the subcellular localization of hepatitis B surface antigen (HBsAg) in liver biopsies of HBsAg—positive patients with cirrhosis. The localization patterns of HBsAg in hepatocytes were membranous, cytoplasmic, festoon and inclusion body types. Cytoplasmic and festoon types were seen more often than the membranous type in pseudolobules, and hepatitis B core antigen (HBcAg)—positive cells with cytoplasmic type were distributed in the periphery of pseudolobules with active inflammation. Immunoelectron microscopy in the cytoplasmic or festoon type of HBsAg showed immunoreaction in the cisternae and on virus-like particles in the cisternae in patients with hepatitis B e antigen (HBeAg) antigenemia. Simultaneous staining of HBsAg and HBcAg revealed that hepatocytes with cytoplasmic or festoon type of HBsAg contained HBcAg—immunoreactivity. The inclusion body type of HBsAg was characteristic of liver cirrhosis with hepatocellular carcinoma (HCC); the subcellular localization of HBsAg was seen in clusters of the endoplasmic reticulum around the nucleus, and HBsAg—immunoreactivity was observed on many virus-like particles in most of the cisternae in those with HBeAg antigenemia. These findings suggest that the synthesis of HBsAg is active in patients with liver cirrhosis and that the formation of HBV is also active in those with HBeAg antigenemia and that HBV may be retained more in cirrhotic livers with hepatocellular carcinoma after proliferation than in those without it.