Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

barS1, a gene for biosynthesis of a gamma-butyrolactone autoregulator,a microbial signaling molecule eliciting antibiotic production in Streptomyces species

From Streptomyces virginiae, in which production of streptogramin antibiotic virginiamycin M(1) and S is tightly regulated by a low-molecular-weight Streptomyces hormone called virginiae butanolide (VB), which is a member of the gamma-butyrolactone autoregulators, the hormone biosynthetic gene (barS1) was cloned and characterized by heterologous expression in Escherichia coli and by gene disruption in S. virginiae. The barS1 gene (a 774-bp open reading frame encoding a 257-amino-acid protein [M(r), 27,095]) is situated in the 10-kb regulator island surrounding the VB-specific receptor gene, barA. The deduced BarS1 protein is weakly homologous to beta-ketoacyl-acyl carrier protein/coenzyme A reductase and belongs to the superfamily of short-chain alcohol dehydrogenase. The function of the BarS1 protein in VB biosynthesis was confirmed by BarS1-dependent in vitro conversion of 6-dehydro-VB-A to VB-A, the last catalytic step in VB biosynthesis. Of the four possible enantiomeric products from racemic 6-dehydro-VB-A as a substrate, only the natural enantiomer of (2R,3R,6S)-VB-A was produced by the purified recombinant BarS1 (rBarS1), indicating that rBarS1 is the stereospecific reductase recognizing (3R)-isomer as a substrate and reducing it stereospecifically to the (6S) product. In the DeltabarS1 mutant created by homologous recombination, the production of VB as well as the production of virginiamycin was lost. The production of virginiamycin by the DeltabarS1 mutant was fully recovered by the external addition of VB to the culture, which indicates that the barS1 gene is essential in the biosynthesis of the autoregulator VBs in S. virginiae and that the failure of virginiamycin production was a result of the loss of VB production.     

Identification by heterologous expression and gene disruption of VisA as L-lysine 2-aminotransferase essential for virginiamycin S biosynthesis in Streptomyces virginiae

The visA gene of Streptomyces virginiae has been thought to be a part of the virginiamycin S (VS) biosynthetic gene cluster based on its location in the middle of genes that encode enzymes highly similar to those participating in the biosynthesis of streptogramin-type antibiotics. Heterologous expression of the visA gene was achieved in Escherichia coli by an N-terminal fusion with thioredoxin (TrxA), and the intact recombinant VisA protein (rVisA) was purified after cleavage with enterokinase to remove the TrxA moiety. The purified rVisA showed clear L-lysine 2-aminotransferase activity with an optimum pH of around 8.0 and an optimum temperature at 35 degrees C, with 2-oxohexanoate as the best amino acceptor, indicating that VisA converts L-lysine into Delta(1)-piperidine 2-carboxylic acid. A visA deletion mutant of S. virginiae was created by homologous recombination, and the in vivo function of the visA gene was studied by phenotypic comparison between the wild type and the visA deletion mutant. No differences in growth in liquid media or in morphological behavior on solid media were observed, indicating that visA is not involved in primary metabolism or morphological differentiation. However, the visA mutant failed to produce VS while maintaining the production of virginiamycin M(1) at a level comparable to that of the parental wild-type strain, demonstrating that visA is essential to VS biosynthesis. These results, together with the observed recovery of the defect in VS production by the external addition of 3-hydroxypicolinic acid (3-HPA), a starter molecule in VS biosynthesis, suggest that VisA is the first enzyme of the VS biosynthetic pathway and that it supplies 3-HPA from L-lysine.     

Association of plasma viral RNA load with prognosis in cats naturally infected with feline immunodeficiency virus

We measured the quantity of plasma feline immunodeficiency virus (FIV) RNA using a real-time sequence detecting system. Plasma viral RNA load was shown to correlate with the clinical stage, survival time, and disease progression in naturally FIV-infected cats. The present study indicates that the plasma viral RNA load can be used as a clinical marker representing the impairment of the immune system and predicting the clinical outcome in FIV-infected cats.     

Termite ecology in a dry evergreen forest in Thailand in terms of stable (δ 13C and δ 15N) and radio (14C, 137Cs and 210Pb) isotopes

Stable (¹³C and ¹⁵N) and radio- (¹⁴C, ¹³⁷Cs and ²¹⁰Pb) isotopes were determined for termites that have been sampled from a dry evergreen forest in Thailand. A wood-feeding termite, Microcerotermes crassus, was separated from soil-feeders: Termes propinquus, Termes comis and Dicuspiditermes makhamensis by ¹³C and ¹⁵N values. The Termes group in Thailand had less diverse values in ¹³C and ¹⁵N than those in Australia, where the feeding habits of the Termes group are more diverse. Other soil-feeding termites produced similar ¹³C values, but a larger range in ¹⁵N values. ¹⁴C-percent modern carbon (pMC) values suggest that the soil-feeding termites used younger carbon than the wood-feeding termites, and this was consistent with the termites from Cameroon, central Africa. Values of ¹³C and ¹⁴C-pMC indicate that surface soil was used by a soil-feeding termite, D. makhamensis, in making the nest mounds, and deeper soil (10–30 cm) by a fungus-growing termite, Macrotermes carbonarius. ²¹⁰Pb and ¹³⁷Cs were scarcely incorporated into the termites, although ²¹⁴Pb was recovered from the workers. The results suggest that stable- and radioisotopes are useful in the study of detritivorous animals, organic matter decomposition and ecosystem engineering.Takuya Abe - deceased.     

L-Cysteine based N-type calcium channel blockers: structure-activity relationships of the C-terminal lipophilic moiety,and oral analgesic efficacy in rat pain models

This study was performed to determine the structure-activity relationships (SAR) of L-cysteine based N-type calcium channel blockers. Basic nitrogen was introduced into the C-terminal lipophilic moiety of L-cysteine with a view toward improvement of its physicochemical properties. L-Cysteine derivative 9 was found to be a potent and selective N-type calcium channel blocker with IC(50) of 0.33 microM in calcium influx assay using IMR-32 cells and was 15-fold selective for N-type calcium channels over L-type channels. Compound 9 showed improved oral analgesic efficacy in the rat formalin induced pain model and the rat chronic constriction injury (CCI) model, which is one of the most reliable models of chronic neuropathic pain, without any significant effect on blood pressure or neurological behavior.     

Adipose tissue selective insulin receptor knockout protects against obesity and obesity-related glucose intolerance

Insulin signaling in adipose tissue plays an important role in lipid storage and regulation of glucose homeostasis. Using the Cre-loxP system, we created mice with fat-specific disruption of the insulin receptor gene (FIRKO mice). These mice have low fat mass, loss of the normal relationship between plasma leptin and body weight, and are protected against age-related and hypothalamic lesion-induced obesity, and obesity-related glucose intolerance. FIRKO mice also exhibit polarization of adipocytes into populations of large and small cells, which differ in expression of fatty acid synthase, C/EBP alpha, and SREBP-1. Thus, insulin signaling in adipocytes is critical for development of obesity and its associated metabolic abnormalities, and abrogation of insulin signaling in fat unmasks a heterogeneity in adipocyte response in terms of gene expression and triglyceride storage.     

Isolation and identification of EG-VEGF/prokineticins as cognate ligands for two orphan G-protein-coupled receptors

Endocrine gland-derived vascular endothelial growth factor (EG-VEGF, identical to prokineticin 1) is a novel peptide recently identified as a selective mitogen for endocrine gland endothelial cells. The present study demonstrates that EG-VEGF/prokineticin 1 and a peptide closely related to EG-VEGF, prokineticin 2, are cognate ligands of two orphan G-protein-coupled receptors designated ZAQ (=EG-VEGF/PK-R1) and I5E (=EG-VEGF/PK-R2). EG-VEGF/prokineticin 1 and prokineticin 2 induced a transient increase in intracellular calcium ion concentration ([Ca(2+)](i)) with nanomolar potency in Chinese hamster ovary (CHO) cells expressing EG-VEGF/PK-R1 and -R2 and bind to these cells with high affinity and with different receptor selectivity. EG-VEGF/prokineticins provoke rapid phosphorylation of p44/42 MAP kinase and DNA synthesis in the bovine adrenal capillary endothelial cells (BACE). The mRNAs of both EG-VEGF/PK-R1 and -R2 were expressed in BACE. The identification of the receptors for EG-VEGF/prokineticins may provide a novel molecular basis for the regulation of angiogenesis in endocrine glands.     

Chloride channel in vanadocytes of a vanadium-rich ascidian Ascidia sydneiensis samea

Ascidians, so-called sea squirts, can accumulate high levels of vanadium in the vacuoles of signet ring cells, which are one type of ascidian blood cell and are also called vanadocytes. In addition to containing high concentrations of vanadium in the +3 oxidation state, the proton concentrations in vanadocyte vacuoles are extremely high. In order to elucidate the entire mechanism of the accumulation and reduction of vanadium by ascidian vanadocytes, it is necessary to clarify the participation of anions, which might be involved as counter ions in the active accumulation of both vanadium and protons. We examined the chloride channel, since chloride ions are necessary for the acidification of intracellular vesicles and coexist with H(+)-ATPase. We cloned a cDNA encoding a chloride channel from blood cells of a vanadium-rich ascidian, Ascidia sydneiensis samea. It encoded a 787-amino-acid protein, which showed striking similarity to mammalian ClC3/4/5-type chloride channels. Using a whole-mount in situ hybridization method that we developed for ascidian blood cells, the chloride channel was revealed to be transcribed in vanadocytes, suggesting its participation in the process of vanadium accumulation.     

Changes in lignin content of leaf litters during mulching

Alkaline nitrobenzene oxidation, ozonation and methoxyl content determinations were applied to decomposing leaf litter of Ginkgo biloba L., Cinnamomum camphora sieb., Zelkova serrata Makino and Firmiana simplex W. F. Wight, respectively, during mulching to investigate the properties and estimate changes in lignin composition and content. Since the Klason lignin residue originated from components highly resistant to degradation by acid, the methoxyl content of Klason residue was used to estimate the lignin content of leaf litter. Quantitative analysis of presumed lignin-derived fragments, by use of alkaline nitrobenzene oxidation and ozonation methods, suggested that the estimated lignin content approximates that of the real lignin content of leaves, which is greatly overestimated by the Klason procedure. The estimated lignin contents ranged from 3.9 to 10.0% while the Klason lignan residue varied from 37.1 to 46.7% in un-mulched leaf litter. The absolute amounts of the measured lignin somewhat decreased during mulching, while the structure of lignin remaining in leaf litters after mulching was considered not to be very different from its original structure.