Simulation of rat behavior by a reinforcement learning algorithm in consideration of appearance probabilities of reinforcement signals

Brown and Wanger [Brown, R.T., Wanger, A.R., 1964. Resistance to punishment and extinction following training with shock or nonreinforcement. J. Exp. Psychol. 68, 503-507] investigated rat behaviors with the following features: (1) rats were exposed to reward and punishment at the same time, (2) environment changed and rats relearned, and (3) rats were stochastically exposed to reward and punishment. The results are that exposure to nonreinforcement produces resistance to the decremental effects of behavior after stochastic reward schedule and that exposure to both punishment and reinforcement produces resistance to the decremental effects of behavior after stochastic punishment schedule. This paper aims to simulate the rat behaviors by a reinforcement learning algorithm in consideration of appearance probabilities of reinforcement signals. The former algorithms of reinforcement learning were unable to simulate the behavior of the feature (3). We improve the former reinforcement learning algorithms by controlling learning parameters in consideration of the acquisition probabilities of reinforcement signals. The proposed algorithm qualitatively simulates the result of the animal experiment of Brown and Wanger.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Heterogenous induction of carcinoma-associated fibroblast-like differentiation in normal human prostatic fibroblasts by co-culturing with prostate cancer cells

In the tumor microenvironment, carcinoma-associated fibroblasts (CAFs) are considered to play a critical role in the promotion of tumorigenesis. However, the mechanisms that generate CAFs are not well elucidated. To understand how CAFs are generated during primary cancer progression, we investigated the biochemical characteristics of normal human prostate stromal cells (PrSC) co-cultured with human prostate cancer (PCa) cells in vitro. In primary cultures of human PCa-derived stromal cells (PCaSC-8 and PCaSC-9), expression of TNC, ACTA2, EGF, FGF7, and IGF1 mRNA was generally higher than PrSC but gene expression patterns were not uniform between PCaSC-8 and PCaSC-9 cells. Transforming growth factor β (TGFβ) and vascular endothelial growth factor (VEGF) protein levels in both PCaSC-8 and PCaSC-9 cells were generally higher than PrSC but levels of both secreted proteins were not same. When PrSCs were co-cultured with androgen-sensitive LNCaP cells or its sublines, androgen-low-sensitive E9 cells and androgen-insensitive AIDL cells, mRNA expression of IGF1 was significantly increased in all combinations. In contrast, expression of COL1A1, TNC, and ACTA2 mRNA was significantly increased only in LNCaP + PrSC and E9 + PrSC co-cultures. Protein production of VEGF was significantly increased only in LNCaP + PrSC and E9 + PrSC co-cultures. Increase of TGFβ protein was observed only in E9 + PrSC co-cultures. These biochemical characteristics of PrSC were partially recapitulated in TGFβ-treated PrSC. We have demonstrated that normal fibroblasts co-cultured with cancer cells become activated and exhibit biochemical characteristics of CAFs in a heterogenous manner. Our results suggest that heterogenous induction of CAF-like differentiation might be strongly dependent on biochemical characteristics of adjacent cancer cells.     

The Bcl-2 Homology Domain 3 (BH3)-only Proteins Bim and Bid Are Functionally Active and Restrained by Anti-apoptotic Bcl-2 Family Proteins in Healthy Liver

An intrinsic pathway of apoptosis is regulated by the B-cell lymphoma-2 (Bcl-2) family proteins. We previously reported that a fine rheostatic balance between the anti- and pro-apoptotic multidomain Bcl-2 family proteins controls hepatocyte apoptosis in the healthy liver. The Bcl-2 homology domain 3 (BH3)-only proteins set this rheostatic balance toward apoptosis upon activation in the diseased liver. However, their involvement in healthy Bcl-2 rheostasis remains unknown. In the present study, we focused on two BH3-only proteins, Bim and Bid, and we clarified the Bcl-2 network that governs hepatocyte life and death in the healthy liver. We generated hepatocyte-specific Bcl-xL- or Mcl-1-knock-out mice, with or without disrupting Bim and/or Bid, and we examined hepatocyte apoptosis under physiological conditions. We also examined the effect of both Bid and Bim disruption on the hepatocyte apoptosis caused by the inhibition of Bcl-xL and Mcl-1. Spontaneous hepatocyte apoptosis in Bcl-xL- or Mcl-1-knock-out mice was significantly ameliorated by Bim deletion. The disruption of both Bim and Bid completely prevented hepatocyte apoptosis in Bcl-xL-knock-out mice and weakened massive hepatocyte apoptosis via the additional in vivo knockdown of mcl-1 in these mice. Finally, the hepatocyte apoptosis caused by ABT-737, which is a Bcl-xL/Bcl-2/Bcl-w inhibitor, was completely prevented in Bim/Bid double knock-out mice. The BH3-only proteins Bim and Bid are functionally active but are restrained by the anti-apoptotic Bcl-2 family proteins under physiological conditions. Hepatocyte integrity is maintained by the dynamic and well orchestrated Bcl-2 network in the healthy liver.     

Cutting edge: CD40 engagement eliminates the need for Bruton's tyrosine kinase in B cell receptor signaling for NF-kappa B

The Tec kinase Bruton's tyrosine kinase (Btk) represents a key intermediary for B cell receptor (BCR) signaling. Btk mutation produces B cell deficiency in mice with X-linked immunodeficiency (xid), and surface Ig-mediated responses of mature B cells are seriously deranged. The central role that Btk plays in directing downstream events produced by BCR engagement is demonstrated by the complete failure of NF-kappa B induction and cellular proliferation following anti-Ig treatment of B cells obtained from xid mice. In this study, we report that the block in BCR signaling produced by Btk mutation is reversed by CD40 engagement. Prior treatment with CD40 ligand normalized subsequent responses of xid B cells to BCR cross-linking, so that typical outcomes of BCR signaling such as NF-kappa B activation and cell cycle progression occurred in a Btk-independent fashion. These results demonstrate that a specific genetic lesion interrupting BCR-mediated intracellular signaling is circumvented through stimulation of CD40.     

Fear Conditioning Induced by Interpersonal Conflicts in Healthy Individuals

Psychophysiological markers have been focused to investigate the psychopathology of psychiatric disorders and personality subtypes. In order to understand neurobiological mechanisms underlying these conditions, fear-conditioning model has been widely used. However, simple aversive stimuli are too simplistic to understand mechanisms because most patients with psychiatric disorders are affected by social stressors. The objective of this study was to test the feasibility of a newly-designed conditioning experiment using a stimulus to cause interpersonal conflicts and examine associations between personality traits and response to that stimulus. Twenty-nine healthy individuals underwent the fear conditioning and extinction experiments in response to three types of stimuli: a simple aversive sound, disgusting pictures, and pictures of an actors’ face with unpleasant verbal messages that were designed to cause interpersonal conflicts. Conditioned response was quantified by the skin conductance response (SCR). Correlations between the SCR changes, and personality traits measured by the Zanarini Rating Scale for Borderline Personality Disorder (ZAN-BPD) and Revised NEO Personality Inventory were explored. The interpersonal conflict stimulus resulted in successful conditioning, which was subsequently extinguished, in a similar manner as the other two stimuli. Moreover, a greater degree of conditioned response to the interpersonal conflict stimulus correlated with a higher ZAN-BPD total score. Fear conditioning and extinction can be successfully achieved, using interpersonal conflicts as a stimulus. Given that conditioned fear caused by the interpersonal conflicts is likely associated with borderline personality traits, this paradigm could contribute to further understanding of underlying mechanisms of interpersonal fear implicated in borderline personality disorder.     

Fabrication of Biomimetic Bone Tissue Using Mesenchymal Stem Cell-Derived Three-Dimensional Constructs Incorporating Endothelial Cells

The development of technologies to promote vascularization of engineered tissue would drive major developments in tissue engineering and regenerative medicine. Recently, we succeeded in fabricating three-dimensional (3D) cell constructs composed of mesenchymal stem cells (MSCs). However, the majority of cells within the constructs underwent necrosis due to a lack of nutrients and oxygen. We hypothesized that incorporation of vascular endothelial cells would improve the cell survival rate and aid in the fabrication of biomimetic bone tissues in vitro. The purpose of this study was to assess the impact of endothelial cells combined with the MSC constructs (MSC/HUVEC constructs) during short- and long-term culture. When human umbilical vein endothelial cells (HUVECs) were incorporated into the cell constructs, cell viability and growth factor production were increased after 7 days. Furthermore, HUVECs were observed to proliferate and self-organize into reticulate porous structures by interacting with the MSCs. After long-term culture, MSC/HUVEC constructs formed abundant mineralized matrices compared with those composed of MSCs alone. Transmission electron microscopy and qualitative analysis revealed that the mineralized matrices comprised porous cancellous bone-like tissues. These results demonstrate that highly biomimetic bone tissue can be fabricated in vitro by 3D MSC constructs incorporated with HUVECs.     

The Suppression of Maternal–Fetal Leukemia Inhibitory Factor Signal Relay Pathway by Maternal Immune Activation Impairs Brain Development in Mice

Recent studies in rodents suggest that maternal immune activation (MIA) by viral infection is associated with schizophrenia and autism in offspring. Although maternal IL-6 is though t to be a possible mediator relating MIA induced these neuropsychiatric disorders, the mechanism remains to be elucidated. Previously, we reported that the maternal leukemia inhibitory factor (LIF)–placental ACTH–fetal LIF signaling relay pathway (maternal–fetal LIF signal relay) promotes neurogenesis of fetal cerebrum in rats. Here we report that the maternal–fetal LIF signal relay in mice is suppressed by injection of polyriboinosinic-polyribocytidylic acid into dams, which induces MIA at 12.5 days post-coitum. Maternal IL-6 levels and gene expression of placental suppressor of cytokine signaling 3 (Socs3) increased according to the severity of MIA and gene expression of placental Socs3 correlated with maternal IL-6 levels. Furthermore, we show that MIA causes reduction of LIF level in the fetal cerebrospinal fluid, resulting in the decreased neurogenesis in the cerebrum. These findings suggest that maternal IL-6 interferes the maternal–fetal LIF signal relay by inducing SOCS3 in the placenta and leads to decreased neurogenesis.     

Establishment of a Patient-Derived Orthotopic Xenograft (PDOX) Model of HER-2-Positive Cervical Cancer Expressing the Clinical Metastatic Pattern

Squamous cell carcinoma of the cervix, highly prevalent in the developing world, is often metastatic and treatment resistant with no standard treatment protocol. Our laboratory pioneered the patient-derived orthotopic xenograft (PDOX) nude mouse model with the technique of surgical orthotopic implantation (SOI). Unlike subcutaneous transplant patient-derived xenograft (PDX) models, PDOX models metastasize. Most importantly, the metastasis pattern correlates to the patient. In the present report, we describe the development of a PDOX model of HER-2-positive cervical cancer. Metastasis after SOI in nude mice included peritoneal dissemination, liver metastasis, lung metastasis as well as lymph node metastasis reflecting the metastatic pattern in the donor patient. Metastasis was detected in 4 of 6 nude mice with primary tumors. Primary tumors and metastases in the nude mice had histological structures similar to the original tumor and were stained by an anti-HER-2 antibody in the same pattern as the patient’s cancer. The metastatic pattern, histology and HER-2 tumor expression of the patient were thus preserved in the PDOX model. In contrast, subcutaneous transplantation of the patient’s cervical tumors resulted in primary growth but not metastasis.