High-level secretory production of phospholipase A1 by Saccharomyces cerevisiae and Aspergillus oryzae

Phospholipase A1 (PLA1) is a hydrolytic enzyme that catalyzes the removal of the acyl group from position 1 of lecithin to form lysolecithin. The PLA1 gene, which had been cloned from Aspergillus oryzae, was expressed in Saccharomyces cerevisiae and A. oryzae. Through the modification of the medium composition and the feeding conditions of substrate, the production level of PLA1 by S. cerevisiae was increased to a level fivefold higher than that indicated in a previous report. In the case of A. oryzae, introduction of multicopies of PLA1 expression units, and the morphological change from the pellet form to the filamentous form were effective for the enhancement of PLA1 production. We succeeded in producing 3,500 U/ml of PLA1 using an industrial-scale fermentor.     

A molecular marker diagnostic of a specific isolate of an arbuscular mycorrhizal fungus,Gigaspora margarita

To investigate the auto-ecology of a strain of Gigaspora margarita in a commercial inoculum, we found a pair of PCR primers amplifying a sequence of 235 bp diagnostic of the isolate. We designed an oligonucleotide probe based on the DNA sequence. The combination of PCR and the probing successfully detected the diagnostic sequence from both DNA preparations of single spores and colonized roots. This protocol enabled us to distinguish the isolate among several isolates from Japan, Nepal and the USA.     

Phosphorylation of neuroglycan C, a brain-specific transmembrane chondroitin sulfate proteoglycan, and its localization in the lipid rafts

Neuroglycan C (NGC) is a brain-specific transmembrane chondroitin sulfate proteoglycan. In the present study, we examined whether NGC could be phosphorylated in neural cells. On metabolic labeling of cultured cerebral cortical cells from the rat fetus with (32)P(i), serine residues in NGC were radiolabeled. Some NGC became detectable in the raft fraction from the rat cerebrum, a signaling microdomain of the plasma membrane, with cerebral development. NGC from the non-raft fraction, not the raft fraction, could be phosphorylated by an in vitro kinase reaction. The phosphorylation of NGC was inhibited by adding to the reaction mixture a recombinant peptide representing the ectodomain of NGC, but not by adding a peptide representing its cytoplasmic domain. NGC could be labeled by an in vitro kinase reaction using [gamma-(32)P]GTP as well as [gamma-(32)P]ATP, and this kinase activity was partially inhibited by 5,6-dichloro-1-beta-d-ribofuranosylbenzimidazole, a selective inhibitor of casein kinase II. In addition to the intracellular phosphorylation, NGC was also phosphorylated at the cell surface by an ectoprotein kinase. This is the first report to demonstrate that NGC can be phosphorylated both intracellularly and pericellularly, and our findings suggest that a kinase with a specificity similar to that of casein kinase II is responsible for the NGC ectodomain phosphorylation.     

On the role of periodism in the origin of proteins

Two different views have been proposed for origins of genes (or proteins). One is that primordial genes evolved from random sequences. This view underlies the concept of modern in vitro evolution experiments that functional molecules (even proteins) evolved from random sequence-libraries. On the contrary, the second view reminds that "random sequences" would be an unusual state in which to find RNA or DNA, because it is their inherent nature to yield periodic structures during the course of semi-conservative replication. In this second view, the periodicity of DNA (or RNA) is responsible for emergence of primordial genes. Although recent reports on the variety of periodicities present in proteins, genes and genomes are consistent with the second view, it has yet to be experimentally tested. We assessed the significance of periodicities of DNA in the origin of genes by constructing such periodic DNAs. The results showed that periodic DNA produced ordered proteins at very high rates, which is in contrast to the fact that proteins with random sequences lack secondary structures. We concluded that periodicity played a pivotal role in the origin of many genes. The observation should pave the way for new experimental evolution systems for proteins.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

barS1, a gene for biosynthesis of a gamma-butyrolactone autoregulator,a microbial signaling molecule eliciting antibiotic production in Streptomyces species

From Streptomyces virginiae, in which production of streptogramin antibiotic virginiamycin M(1) and S is tightly regulated by a low-molecular-weight Streptomyces hormone called virginiae butanolide (VB), which is a member of the gamma-butyrolactone autoregulators, the hormone biosynthetic gene (barS1) was cloned and characterized by heterologous expression in Escherichia coli and by gene disruption in S. virginiae. The barS1 gene (a 774-bp open reading frame encoding a 257-amino-acid protein [M(r), 27,095]) is situated in the 10-kb regulator island surrounding the VB-specific receptor gene, barA. The deduced BarS1 protein is weakly homologous to beta-ketoacyl-acyl carrier protein/coenzyme A reductase and belongs to the superfamily of short-chain alcohol dehydrogenase. The function of the BarS1 protein in VB biosynthesis was confirmed by BarS1-dependent in vitro conversion of 6-dehydro-VB-A to VB-A, the last catalytic step in VB biosynthesis. Of the four possible enantiomeric products from racemic 6-dehydro-VB-A as a substrate, only the natural enantiomer of (2R,3R,6S)-VB-A was produced by the purified recombinant BarS1 (rBarS1), indicating that rBarS1 is the stereospecific reductase recognizing (3R)-isomer as a substrate and reducing it stereospecifically to the (6S) product. In the DeltabarS1 mutant created by homologous recombination, the production of VB as well as the production of virginiamycin was lost. The production of virginiamycin by the DeltabarS1 mutant was fully recovered by the external addition of VB to the culture, which indicates that the barS1 gene is essential in the biosynthesis of the autoregulator VBs in S. virginiae and that the failure of virginiamycin production was a result of the loss of VB production.     

Identification by heterologous expression and gene disruption of VisA as L-lysine 2-aminotransferase essential for virginiamycin S biosynthesis in Streptomyces virginiae

The visA gene of Streptomyces virginiae has been thought to be a part of the virginiamycin S (VS) biosynthetic gene cluster based on its location in the middle of genes that encode enzymes highly similar to those participating in the biosynthesis of streptogramin-type antibiotics. Heterologous expression of the visA gene was achieved in Escherichia coli by an N-terminal fusion with thioredoxin (TrxA), and the intact recombinant VisA protein (rVisA) was purified after cleavage with enterokinase to remove the TrxA moiety. The purified rVisA showed clear L-lysine 2-aminotransferase activity with an optimum pH of around 8.0 and an optimum temperature at 35 degrees C, with 2-oxohexanoate as the best amino acceptor, indicating that VisA converts L-lysine into Delta(1)-piperidine 2-carboxylic acid. A visA deletion mutant of S. virginiae was created by homologous recombination, and the in vivo function of the visA gene was studied by phenotypic comparison between the wild type and the visA deletion mutant. No differences in growth in liquid media or in morphological behavior on solid media were observed, indicating that visA is not involved in primary metabolism or morphological differentiation. However, the visA mutant failed to produce VS while maintaining the production of virginiamycin M(1) at a level comparable to that of the parental wild-type strain, demonstrating that visA is essential to VS biosynthesis. These results, together with the observed recovery of the defect in VS production by the external addition of 3-hydroxypicolinic acid (3-HPA), a starter molecule in VS biosynthesis, suggest that VisA is the first enzyme of the VS biosynthetic pathway and that it supplies 3-HPA from L-lysine.     

Guide oligonucleotide-dependent DNA linkage that facilitates controllable polymerization of microgene blocks

Faster and more efficient searches of a huge protein sequence space for the purpose of conducting experiments in protein evolution can be achieved through the development of a block shuffling-based evolution system. One of the key components of such a system is the accurate and efficient linkage of gene units. Here we introduce a new method that allows accurate and controllable linkage of microgene blocks. This method employs a thermostable DNA ligase that links two single-stranded microgene blocks when they hybridize a complementary guide oligonucleotide. At high temperature, the ligation of the microgene units is fully dependent on the guide oligonucleotide, which can exclude undesired polymer formation, including the incorporation of microgenes having illegitimate sizes and "head-to-head" and "tail-to-tail" ligation of blocks. We were also able to assemble three microgene units using two guide oligonucleotides. Using this method of controllable linkage should facilitate further development of a step-by-step system for the polymerization of gene blocks, leading to a versatile block shuffling-based protein evolution system.