Enhancement of cytotoxic T-lymphocyte responses in patients with gastrointestinal malignancies following vaccination with CEA peptide–pulsed dendritic cells

Carcinoembryonic antigen (CEA) is strongly expressed in a vast majority of gastrointestinal carcinomas. Recently, epitope peptides of CEA were identified. We have demonstrated HLA-A24–restricted peptide, CEA652[9] (TYACFVSNL), was capable of eliciting specific cytotoxic T lymphocytes (CTLs) which could lyse tumor cells expressing HLA-A24 and CEA. HLA-A24 is the most applicable MHC class I allele in the Japanese population. In this pilot study, we have used the peptide-pulsed dendritic cells (DCs) generated from peripheral blood mononuclear cells (PBMCs) supplemented with GM-CSF and IL-4 as the source of the vaccine. Eight patients with advanced CEA-expressing gastrointestinal malignancies received subcutaneous injections every 2 or 3 weeks. Immunomonitoring was performed by ELISpot (enzyme-linked immunosorbent spot) assay to measure the precursor frequency of CTLs and their capacity to elicit antitumor CTLs in vitro. Four of seven patients have developed their CTL response after vaccinations. DTH reaction was observed in one of eight patients at the DC-injected site. Skin biopsy at the injected site showed the infiltration of the lymphocytes. Furthermore, A24/CEA peptide tetramer assay revealed an increase in peptide-specific T-cell precursor frequency in vaccinated patients. No significant toxic adverse effects were observed, except for mild diarrhea in one case after three vaccinations. Three patients have shown stabilization of the disease after vaccinations. In conclusion, our results clearly demonstrated that our vaccination protocol was safe and might develop a CEA-specific CTL response in cancer patients.     

The Tom40 assembly process probed using the attachment of different intramitochondrial sorting signals

The TOM40 complex is a protein translocator in the mitochondrial outer membrane and consists of several different subunits. Among them, Tom40 is a central subunit that constitutes a protein-conducting channel by forming a β-barrel structure. To probe the nature of the assembly process of Tom40 in the outer membrane, we attached various mitochondrial presequences to Tom40 that possess sorting information for the intermembrane space (IMS), inner membrane, and matrix and would compete with the inherent Tom40 assembly process. We analyzed the mitochondrial import of those fusion proteins in vitro. Tom40 crossed the outer membrane and/or inner membrane even in the presence of various sorting signals. N-terminal anchorage of the attached presequence to the inner membrane did not prevent Tom40 from associating with the TOB/SAM complex, although it impaired its efficient release from the TOB complex in vitro but not in vivo. The IMS or matrix-targeting presequence attached to Tom40 was effective in substituting for the requirement for small Tim proteins in the IMS for the translocation of Tom40 across the outer membrane. These results provide insight into the mechanism responsible for the precise delivery of β-barrel proteins to the outer mitochondrial membrane.     

Human Pluripotent Stem Cell-Derived Tumor Model Uncovers the Embryonic Stem Cell Signature as a Key Driver in Atypical Teratoid/Rhabdoid Tumor

1. Download high-res image (211KB)
2. Download full-size image

     

Pyrrospirones A and B, apoptosis inducers in HL-60 cells, from an endophytic fungus, Neonectria ramulariae Wollenw KS-246

Pyrrospirones A and B have been isolated from unpolished rice cultures of the endophytic fungus Neonectria ramulariae Wollenw KS-246. Their absolute stereostructures (1 and 2) were elucidated through spectroscopic methods using 1D and 2D NMR techniques and chemical transformations, including the modified Mosher's method. The compounds exhibited cytotoxicity and induced apoptosis in human promyelocytic leukemia HL-60 cells.     

Design,synthesis, and evaluation of polyamine-memantine hybrids as NMDA channel blockers

N-Methyl-d-aspartate (NMDA) receptors have been implicated in learning and memory, and may also play a central role in various conditions leading to neuronal degradation. NMDA receptor antagonists could therefore be of therapeutic benefit for a number of neurological disorders. We have designed hybrid compounds of polyamines and memantine, both of which function as NMDA channel blockers. The triamine derivative with a guanidine moiety showed more potent antagonistic activity than memantine.     

Correction to: Comparison of the usability of an automatic sleep staging program via portable 1-channel electroencephalograph and manual sleep staging with traditional polysomnography

Sleep and Biological Rhythms -     

Ex vivo characterization of γδ T-cell repertoire in patients after adoptive transfer of Vγ9Vδ2 T cells expressing the interleukin-2 receptor β-chain and the common γ-chain

Background aimsAdoptive immunotherapy is emerging as a potent anti-tumor treatment modality; Vγ9Vδ2 T cells may represent appropriate agents for such cancer immunotherapy. To improve the currently limited success of Vγ9Vδ2 T-cell–based immunotherapy, we examined the in vivo dynamics of these adoptively-transferred cells and hypothesized that interleukin (IL)-15 is the potential factor for Vγ9δ2 T cell in vivo survival.MethodsWe conducted a clinical trial of adoptive Vγ9Vδ2 T-cell transfer therapy in six colorectal cancer patients who received pulmonary metastasectomy. Patients' peripheral blood mononuclear cells were stimulated with zoledronate (5 μmol/L) and IL-2 (1000 IU/mL) for 14 d. Harvested cells, mostly Vγ9Vδ2 T cells, were given intravenously weekly without additional IL-2 eight times in total. The frequency, phenotype and common γ-chain cytokine receptor expression of Vγ9Vδ2 T cells in peripheral blood was monitored by flow cytometry at each time point during treatment and 4 and 12 weeks after the last administration.ResultsAdoptively transferred Vγ9Vδ2 T cells expanded well without exogenous IL-2 administration or lymphodepleting preconditioning. They maintained effector functions in terms of interferon-γ secretion and prompt release of cytotoxic granules in response to PMA/ionomycin or isopentenyl pyrophosphate–positive cells. Because they are IL-2Rα^?IL-7Rα^?IL-15Rα^?IL-2Rβ⁺γ_c⁺, it is likely that IL-2 or IL-15 is required for their maintenance.ConclusionsThe persistence of large numbers of functionally active adoptively transferred Vγ9Vδ2 T cells in the absence of exogenous IL-2 implies that an endogenous factor, such as IL-15 transpresentation, is adequate to support these cells in vivo.     

Simulation of rat behavior by a reinforcement learning algorithm in consideration of appearance probabilities of reinforcement signals

Brown and Wanger [Brown, R.T., Wanger, A.R., 1964. Resistance to punishment and extinction following training with shock or nonreinforcement. J. Exp. Psychol. 68, 503-507] investigated rat behaviors with the following features: (1) rats were exposed to reward and punishment at the same time, (2) environment changed and rats relearned, and (3) rats were stochastically exposed to reward and punishment. The results are that exposure to nonreinforcement produces resistance to the decremental effects of behavior after stochastic reward schedule and that exposure to both punishment and reinforcement produces resistance to the decremental effects of behavior after stochastic punishment schedule. This paper aims to simulate the rat behaviors by a reinforcement learning algorithm in consideration of appearance probabilities of reinforcement signals. The former algorithms of reinforcement learning were unable to simulate the behavior of the feature (3). We improve the former reinforcement learning algorithms by controlling learning parameters in consideration of the acquisition probabilities of reinforcement signals. The proposed algorithm qualitatively simulates the result of the animal experiment of Brown and Wanger.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.