Regulation of inositol 1,4,5-trisphosphate receptor type 1 function during oocyte maturation by MPM-2 phosphorylation

Egg activation and further embryo development require a sperm-induced intracellular Ca²⁺ signal at the time of fertilization. Prior to fertilization, the egg's Ca²⁺ machinery is therefore optimized. To this end, during oocyte maturation, the sensitivity, i.e. the Ca²⁺ releasing ability, of the inositol 1,4,5-trisphosphate receptor type 1 (IP₃R1), which is responsible for most of this Ca²⁺ release, markedly increases. In this study, the recently discovered specific Polo-like kinase (Plk) inhibitor BI2536 was used to investigate the role of Plk1 in this process. BI2536 inactivates Plk1 in oocytes at the early stages of maturation and significantly decreases IP₃R1 phosphorylation at an MPM-2 epitope at this stage. Moreover, this decrease in Plk1-dependent MPM-2 phosphorylation significantly lowers IP₃R1 sensitivity. Finally, using in vitro phosphorylation techniques we identified T²⁶⁵⁶ as a major Plk1 site on IP₃R1. We therefore propose that the initial increase in IP₃R1 sensitivity during oocyte maturation is underpinned by IP₃R1 phosphorylation at an MPM-2 epitope(s).     

CFH, VEGF, and PEDF genotypes and the response to intravitreous injection of bevacizumab for the treatment of age-related macular degeneration

We determined whether there is an association between complement factor H (CFH), high-temperature requirement A-1 (HTRA1), vascular endothelial growth factor (VEGF), and pigment epithelium-derived factor (PEDF) genotypes and the response to treatment with a single intravitreous injection of bevacizumab for age-related macular degeneration (AMD). Eighty-three patients with exudative AMD treated by bevacizumab injection were genotyped for three single nucleotide polymorphisms (SNPs; rs800292, rs1061170, rs1410996) in the CFH gene, a rs11200638-SNP in the HTRA1 gene, three SNPs (rs699947, rs1570360, rs2010963) in the VEGF gene, and four SNPs (rs12150053, rs12948385, rs9913583, rs1136287) in the PEDF gene using a TaqMan assay. The CT genotype (heterozygous) of CFH-rs1061170 was more frequently represented in nonresponders in vision than TT genotypes (nonrisk allele homozygous) at the time points of 1 and 3 months, while there was no CC genotype (risk allele homozygous) in our study cohort (p = 7.66 × 10⁻³, 7.83 × 10⁻³, respectively). VEGF-rs699947 was also associated with vision changes at 1 month and PEDF-rs1136287 at 3 months (p = 5.11 × 10⁻³, 2.05 × 10⁻², respectively). These variants may be utilized for genetic biomarkers to estimate visual outcomes in the response to intravitreal bevacizumab treatment for AMD.     

Probiotic Lactobacillus casei activates innate immunity via NF-kappaB and p38 MAP kinase signaling pathways

Probiotic bacteria are microorganisms that benefit the host through improvement of the balance of intestinal microflora and possibly by augmentation of host defense systems. We examined the mechanisms for the up-regulation of innate immune responses by a probiotic Lactobacillus casei ATCC27139, in vivo. Using mouse models of systemic Listeria monocytogenes infection and MethA fibrosarcoma tumorigenesis in combination with BALB/c and SCID mice, we found that parenteral administration of L. casei ATCC27139 confers a protective effect against L. monocytogenes infection and anti-tumor activity against MethA fibrosarcoma by activation of innate immunity, while L. casei ATCC27139-J1R strains, which are J1 phage-resistant strains that have been selected from MNNG-treated clones, lacked these activities. Substantial differences between ATCC27139 and ATCC27139-J1R strains were observed in the capacity to induce innate cytokines such as TNF-alpha, IL-12, IL-18, and IFN-gamma, and pathogen-associated molecular pattern receptors, TLR2 and Nod2, by spleen cells. In addition, although phosphorylation of NF-kappaB p65 in spleen was equally enhanced in the ATCC27139- and the ATCC27139-J1R-treated groups, phosphorylation of both p38 MAPK and MAPKAPK-2 was significantly induced only by ATCC27139. Furthermore, inhibitors of NF-kappaB (sulfasalazine) and p38 MAPK (SB203580) significantly reduced cytokine production by the spleen cells of the mice treated with L. casei ATCC27139, suggesting that both NF-kappaB and p38 MAPK signaling pathways play important roles in the augmentation of innate immunity by the probiotic L. casei.     

Prasinoxanthin is absent in the green-colored dinoflagellate Lepidodinium chlorophorum strain NIES-1868: pigment composition and 18S rRNA phylogeny

Green-colored plastids in the dinoflagellates Lepidodinium chlorophorum and L. viride have been widely believed as the remnant of an endosymbiotic prasinophyte. This hypothesis for the origin of the Lepidodinium plastids is solely based on an unpublished result quoted in Elbr?chter and Schnepf (Phycologia 35:381–393, 1996) hinting at the presence of a characteristic carotenoid in prasinophytes, prasinoxanthin, in the L. chlorophorum cells. On the other hand, a recent work failed to detect prasinoxanthin in a culture of L. chlorophorum. Unfortunately, we cannot conduct any additional experiments to examine whether the two strains considered in the previous studies are truly of L. chlorophorum, as neither of the two strains is publicly available. We here investigated the pigment composition of L. chlorophorum strain NIES-1868 maintained as a mono-algal culture under laboratory conditions, and detected no sign of prasinoxanthin. The pigment composition of strain NIES-1868 is consistent with previous phylogenetic analyses based on plastid-encoded genes of the same strain, which successfully excluded prasinoxanthin-containing algae from the origin of the L. chlorophorum plastid. We also determined nucleus-encoded 18S ribosomal RNA (rRNA) genes from four Lepidodinium strains (including strain NIES-1868). Analyses of 18S rRNA sequences showed an extremely close relationship among strain NIES-1868 and other Lepidodinium cells/strains originating from different geological locations, suggesting that the cells/strains corresponding to these rRNA sequences lack prasinoxanthin.     

Esterification of Escherichia coli tRNAs with D-histidine and D-lysine by aminoacyl-tRNA synthetases

It is generally believed that only L-amino acids are acceptable in protein synthesis, though some D-amino acids, including D-tyrosine, D-aspartate, and D-tryptophan are known to be bound enzymatically to tRNAs. In this report, we newly show that D-histidine and D-lysine are also able to be the substrates of respective Escherichia coli aminoacyl-tRNA synthetases.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Structure-activity relationship studies of sphingosine-1-phosphate receptor agonists with N-cinnamyl-β-alanine moiety

Structure-activity relationship of sphingosine-1-phosphate receptor agonist was examined. In terms of reducing the flexibility of molecule, hit compound 1 was modified to improve S1P₁ agonistic activity as well as selectivity over S1P₃ agonistic activity. Novel S1P agonists with cinnamyl scaffold or 1,2,5,6-tetrahydropyridine scaffold were identified.     

Distinct tRNA modifications in the thermo-acidophilic archaeon, Thermoplasma acidophilum

Thermoplasma acidophilum is a thermo-acidophilic archaeon. We purified tRNA^Leu (UAG) from T. acidophilum using a solid-phase DNA probe method and determined the RNA sequence after determining via nucleoside analysis and m⁷G-specific aniline cleavage because it has been reported that T. acidophilum tRNA contains m⁷G, which is generally not found in archaeal tRNAs. RNA sequencing and liquid chromatography–mass spectrometry revealed that the m⁷G modification exists at a novel position 49. Furthermore, we found several distinct modifications, which have not previously been found in archaeal tRNA, such as 4-thiouridine9, archaeosine13 and 5-carbamoylmethyuridine34. The related tRNA modification enzymes and their genes are discussed.     

Negative regulation of NK cell activities by inhibitory receptor CD94/NKG2A leads to altered NK cell-induced modulation of dendritic cell functions in chronic hepatitis C virus infection

NK cells are potent activators of dendritic cells (DCs), but it remains obscure how third-party cells affect the ability of NK cells to modulate DC functions. We show here that NK cells derived from healthy donors (N-NK), when cocultured with human liver epithelial cells, induced maturation as well as activation of DCs, such as increased migratory capacity as well as T cell stimulatory activity. In contrast, NK cells from chronic hepatitis C virus-infected donors (HCV-NK) were not capable of activating DCs under the same conditions. In comparison to N-NK, HCV-NK showed higher expression of CD94/NKG2A and produced IL-10 and TGFbeta when cultured with hepatic cells, most of which express HLA-E, a ligand for CD94/NKG2A. Blockade of NKG2A restored the ability of HCV-NK to activate DCs, which appeared to result from the reduced NK cell production of IL-10 and TGFbeta. The blockade also endowed HCV-NK with an ability to drive DCs to generate Th1-polarized CD4+ T cells. These findings show that NK cell modulation of DCs is regulated by third-party cells through NK receptor and its ligand interaction. Aberrant expression of NK receptors may have an impact on the magnitude and direction of DC activation of T cells under pathological conditions, such as chronic viral infection.     

Antimicrobial activity of lipoprotein particles containing apolipoprotein Al

Human plasmain vitro inhibits the growth of coagulase negative staphylococci,S. epidermidis, which may be pathogenic in the immunocompromised host. To determine the antimicrobial components, serum was fractionated by column chromatography, which revealed that elution areas where lipoproteins can be yielded had high antimicrobial activity againstS. epidermidis. Therefore, lipoprotein fractions, including very low density lipoprotein (VLDL), low density lipoprotein (LDL) and high density lipoprotein (HDL), were separated by ultracentrifugation and incubated withS. epidermidis. All 3 lipoprotein fractions suppressed bacterial growth within the first 3 h but VLDL enhanced bacterial growth after 9 h of incubation compared with the control. HDL, however, inhibited bacterial growth throughout 21 h of incubation.To confirm these results, serum from healthy volunteers was separated by ion exchange column chromatography and again by HPLC to purify the antimicrobial fraction. In the protein analysis with gradient polyacrylamide-SDS gel, apolipoprotein Al (apo Al), which is a major apolipoprotein of HDL, was detected in the antimicrobial fraction. Therefore, this fraction was loaded onto an immunoaffinity column coupled with the anti-apo Al monoclonal antibody (Mab). Unbound fraction had no antimicrobial activity, but anti-S. epidermidis activity was recovered from the bound fraction which consisted mainly of apo Al, All and apo C in protein composition.These results indicated that the antimicrobial activity was associated with the apo Al-containing lipoprotein particles (HDL). This property of HDL may directly affect bacterial growth and promote the self-defense mechanisms of normal and immunocompromised individuals.