Prasinoxanthin is absent in the green-colored dinoflagellate Lepidodinium chlorophorum strain NIES-1868: pigment composition and 18S rRNA phylogeny

Green-colored plastids in the dinoflagellates Lepidodinium chlorophorum and L. viride have been widely believed as the remnant of an endosymbiotic prasinophyte. This hypothesis for the origin of the Lepidodinium plastids is solely based on an unpublished result quoted in Elbr?chter and Schnepf (Phycologia 35:381–393, 1996) hinting at the presence of a characteristic carotenoid in prasinophytes, prasinoxanthin, in the L. chlorophorum cells. On the other hand, a recent work failed to detect prasinoxanthin in a culture of L. chlorophorum. Unfortunately, we cannot conduct any additional experiments to examine whether the two strains considered in the previous studies are truly of L. chlorophorum, as neither of the two strains is publicly available. We here investigated the pigment composition of L. chlorophorum strain NIES-1868 maintained as a mono-algal culture under laboratory conditions, and detected no sign of prasinoxanthin. The pigment composition of strain NIES-1868 is consistent with previous phylogenetic analyses based on plastid-encoded genes of the same strain, which successfully excluded prasinoxanthin-containing algae from the origin of the L. chlorophorum plastid. We also determined nucleus-encoded 18S ribosomal RNA (rRNA) genes from four Lepidodinium strains (including strain NIES-1868). Analyses of 18S rRNA sequences showed an extremely close relationship among strain NIES-1868 and other Lepidodinium cells/strains originating from different geological locations, suggesting that the cells/strains corresponding to these rRNA sequences lack prasinoxanthin.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Cardiac neural crest cells contribute to the dormant multipotent stem cell in the mammalian heart

Arodent cardiac side population cell fraction formed clonal spheroids in serum-free medium, which expressed nestin, Musashi-1, and multi-drug resistance transporter gene 1, markers of undifferentiated neural precursor cells. These markers were lost following differentiation, and were replaced by the expression of neuron-, glial-, smooth muscle cell-, or cardiomyocyte-specific proteins. Cardiosphere-derived cells transplanted into chick embryos migrated to the truncus arteriosus and cardiac outflow tract and contributed to dorsal root ganglia, spinal nerves, and aortic smooth muscle cells. Lineage studies using double transgenic mice encoding protein 0-Cre/Floxed-EGFP revealed undifferentiated and differentiated neural crest-derived cells in the fetal myocardium. Undifferentiated cells expressed GATA-binding protein 4 and nestin, but not actinin, whereas the differentiated cells were identified as cardiomyocytes. These results suggest that cardiac neural crest-derived cells migrate into the heart, remain there as dormant multipotent stem cells-and under the right conditions-differentiate into cardiomyocytes and typical neural crest-derived cells, including neurons, glia, and smooth muscle.     

Flocculation and pentadecane production of a novel filamentous cyanobacterium <Emphasis Type="Italic">Limnothrix</Emphasis> sp. strain SK1-2-1

Objective

A novel filamentous cyanobacterium, a photosynthesizing microorganism, was isolated from a river, and its unique features of flocculation and pentadecane production were characterized.

Results

Microscopic observations and a phylogenetic analysis with 16S rDNA revealed that this strain was a Limnothrix species denoted as the SK1-2-1 strain. Auto cell-flocculation was observed when this strain was exposed to a two-step incubation involving a standing cultivation following a shaking preincubation. Flocculation was enhanced by blue light at a wavelength at 470 nm and irradiation for several hours to 1 day. Moreover, the strain exhibiting exponential cell growth may preferentially accumulate alkanes as pentadecane C₁₅H₃₂ alkane, which may be used as jet fuel, at a range of approximately 1% in the dry cell weight of flocculated cells.

Conclusion

This is the first study on biofuel production using flocculated cells in which the specific manner of production may be regulated by cultivation conditions.

     

Molecular Cloning and DNA Analysis of the Orotidine-5′-Phosphate Decarboxylase Gene from the Yeast Saccharomyces exiguus Yp74L-3

The orotidine-5′-phosphate decarboxylase gene of Saccharomyces exiguus Yp74L-3 was cloned as a DNA fragment complementing a ura4 mutation of this yeast. The coding region of the gene is 807 bp in length, and represents 68.7% similarity to the corresponding gene of S. cerevisiae (URA3). The cloned URA4 gene was shown to be located on the 790-kbp Chromosome (chr) VIII of S. exiguus Yp74L-3. The neighbor-joining phylogenetic tree based on the orotidine-5′-phosphate decarboxylase coding sequences indicates that S. exiguus Yp74L-3 is closely related to Kluyveromyces yeasts, as well as to a S. cerevisiae laboratory strain. Received: 4 February 2000 / Accepted: 3 July 2000     

Alterations in hepatitis B virus nucleotide sequences in a chronic virus carrier from immunotolerant to immunoactive phase

Factors involved in transition from the immunotolerant to immunoactive phase in chronic hepatitis B virus (HBV) infection remain unclear. We investigated viral mutations occurring during transition and elucidated their virological and immunological significance. Full-length HBV DNA sequences were serially determined in a chronic HBV carrier from the immunotolerant to immunoactive phase. Viral replicative competence was examined by transfection analysis. HBV-specific CD8⁺ T cell response was evaluated by coculture of CD8⁺ T cells with autologous dendritic cells followed by interferon-γ Elispot assay. Eleven point mutations and two deletions appeared around the onset of the immunoactive phase. Viral replicative competence declined significantly after the onset of active hepatitis. Examination of the CD8⁺ T cell response against two putative T-cell epitopes, which contained substituted amino acids from the immunotolerant to immunoactive phase, showed that mutant HBV epitopes gave a lesser T cell response than wild-type HBV ones. In summary, point mutations and deletions may occur prior to or concurrent with the onset of the immunoactive phase during chronic HBV infection. These mutations may result in a significant decrease in both viral replicative competence and HBV-specific CD8⁺ T cell response, suggesting a possible adaptation for the maintenance of viral persistence.     

Probiotic Lactobacillus casei activates innate immunity via NF-kappaB and p38 MAP kinase signaling pathways

Probiotic bacteria are microorganisms that benefit the host through improvement of the balance of intestinal microflora and possibly by augmentation of host defense systems. We examined the mechanisms for the up-regulation of innate immune responses by a probiotic Lactobacillus casei ATCC27139, in vivo. Using mouse models of systemic Listeria monocytogenes infection and MethA fibrosarcoma tumorigenesis in combination with BALB/c and SCID mice, we found that parenteral administration of L. casei ATCC27139 confers a protective effect against L. monocytogenes infection and anti-tumor activity against MethA fibrosarcoma by activation of innate immunity, while L. casei ATCC27139-J1R strains, which are J1 phage-resistant strains that have been selected from MNNG-treated clones, lacked these activities. Substantial differences between ATCC27139 and ATCC27139-J1R strains were observed in the capacity to induce innate cytokines such as TNF-alpha, IL-12, IL-18, and IFN-gamma, and pathogen-associated molecular pattern receptors, TLR2 and Nod2, by spleen cells. In addition, although phosphorylation of NF-kappaB p65 in spleen was equally enhanced in the ATCC27139- and the ATCC27139-J1R-treated groups, phosphorylation of both p38 MAPK and MAPKAPK-2 was significantly induced only by ATCC27139. Furthermore, inhibitors of NF-kappaB (sulfasalazine) and p38 MAPK (SB203580) significantly reduced cytokine production by the spleen cells of the mice treated with L. casei ATCC27139, suggesting that both NF-kappaB and p38 MAPK signaling pathways play important roles in the augmentation of innate immunity by the probiotic L. casei.     

Osteopontin Deficiency Accelerates Spontaneous Colitis in Mice with Disrupted Gut Microbiota and Macrophage Phagocytic Activity

Background

Osteopontin (OPN) is a multifunctional protein expressed in a variety of tissues and cells. Recent studies revealed increased OPN expression in the inflamed intestinal tissues of patients with inflammatory bowel disease (IBD). The role of OPN in the pathophysiology of IBD, however, remains unclear.

Aims

To investigate the role of OPN in the development of intestinal inflammation using a murine model of IBD, interleukin-10 knock out (IL-10 KO) mice.

Methods

We compared the development of colitis between IL-10 KO and OPN/IL-10 double KO (DKO) mice. OPN expression in the colonic tissues of IL-10 KO mice was examined by fluorescence in situ hybridization (FISH) analysis. Enteric microbiota were compared between IL-10 KO and OPN/IL-10 DKO mice by terminal restriction fragment length polymorphism analysis. The effect of OPN on macrophage phagocytic function was evaluated by phagocytosis assay.

Results

OPN/IL-10 DKO mice had an accelerated onset of colitis compared to IL-10 KO mice. FISH analysis revealed enhanced OPN synthesis in the colonic epithelial cells of IL-10 KO mice. OPN/IL-10 DKO mice had a distinctly different enteric bacterial profile with a significantly lower abundance of Clostridium subcluster XIVa and a greater abundance of Clostridium cluster XVIII compared to IL-10 KO mice. Intracellular OPN deletion in macrophages impaired phagocytosis of fluorescence particle-conjugated Escherichia coli in vitro. Exogenous OPN enhanced phagocytosis by OPN-deleted macrophages when administered at doses of 1 to 100 ng/ml, but not 1000 ng/ml.

Conclusions

OPN deficiency accelerated the spontaneous development of colitis in mice with disrupted gut microbiota and macrophage phagocytic activity.     

Increased Serum LIGHT Levels Correlate with Disease Progression and Severity of Interstitial Pneumonia in Patients with Dermatomyositis: A Case Control Study

BackgroundActivated CD8+ T cells play an important role in the pathogenesis of dermatomyositis (DM) with interstitial pneumonia (IP). Serum CD8+ T-cell activator, LIGHT, and Th1/Th2/Th17 cytokines were measured in DM-IP patients and compared with clinical parameters to investigate their usefulness.MethodsThe correlations between the clinical findings and serum LIGHT and Th1/Th2/Th17 cytokine levels were investigated in 21 patients with DM-IP (14 with rapidly progressive IP [RPIP] and 7 with chronic IP [CIP], including 4 fatal cases of IP).ResultsThe median serum LIGHT level was 119 (16–335.4) pg/ml, which was higher than that in healthy control subjects and DM patients without IP. The median serum IL–6 level was 14.7 (2.4–154.5) pg/ml (n = 13). The other cytokines were detected in only a few patients. The median serum LIGHT level in DM-RPIP patients (156 [49.6–335.4] pg/ml) was significantly higher than that in DM-CIP patients (94.3 [16–164.2] pg/ml) (P = 0.02). The serum IL–6 level did not correlate with either progression or outcome of DM-IP. ROC curve analysis determined a serum LIGHT level of ≥120 pg/ml to be the cut-off value for the rapid progression of DM-IP. Serum LIGHT levels correlated significantly with %DLco (R = 0.55, P = 0.04) and total ground-glass opacity scores (R = 0.72, P = 0.0002). The serum LIGHT level significantly decreased to 100.5 (12.4–259.3) pg/ml 4 weeks after treatment initiation (P = 0.04).ConclusionsThe serum LIGHT level may be a promising marker of disease progression and severity in patients with DM-IP.     

Aboveground biomass and litterfall ofPinus pumila scrubs growing on the Kiso mountain range in central Japan

Aboveground biomass and litterfall ofPinus pumila scrubs, growing on the Kiso mountain range in central Japan, were investigated from 1984 to 1985. The biomass of two research plots (P1 and P2) with different scrub heights was estimated by two methods, the stratified clip technique and the allometric method. Aboveground total biomass estimated by the latter method reached 181 ton d.w. ha⁻¹ in P1 and 132 ton d.w. ha⁻¹ in P2. Creeping stems contributed to about half of the total biomass. Although estimates of woody organs differed between the two plots, leaf biomass estimates were almost the same at 15.5 ton d.w. ha⁻¹. The canopies of the twoP. pumila scrubs were characterized by a large mean leaf area density of 5.0 m² m⁻³. Despite this large area density, relatively moderate attenuation of light intensity was observed. Specific leaf area generally increased with reduced leaf height. Annual total litterfall was estimated to be 3.60 ton d.w. ha⁻¹ yr⁻¹ in P1 and 2.39 ton d.w. ha⁻¹ yr⁻¹ in P2. Annual leaf fall in both plots was approximately 2.0 ton d.w. ha⁻¹ yr⁻¹. Leaves fell mainly in early autumn. Annual loss rates of branches, estimated as the sum of annual branch litterfall and the amount of newly formed attached dead branches, were 0.29 ton d.w. ha⁻¹ yr⁻¹ in P1 and 0.37 ton d.w. ha⁻¹ yr⁻¹ in P2.