Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

FORTE: a profile-profile comparison tool for protein fold recognition

We present FORTE, a profile-profile comparison tool for protein fold recognition. Users can submit a protein sequence to explore the possibilities of structural similarity existing in known structures. Results are reported via email in the form of pairwise alignments.     

Structural and Enzymatic Characterization of Os3BGlu6, a Rice β-Glucosidase Hydrolyzing Hydrophobic Glycosides and (1→3)- and (1→2)-Linked Disaccharides

Glycoside hydrolase family 1 (GH1) β-glucosidases play roles in many processes in plants, such as chemical defense, alkaloid metabolism, hydrolysis of cell wall-derived oligosaccharides, phytohormone regulation, and lignification. However, the functions of most of the 34 GH1 gene products in rice (Oryza sativa) are unknown. Os3BGlu6, a rice β-glucosidase representing a previously uncharacterized phylogenetic cluster of GH1, was produced in recombinant Escherichia coli. Os3BGlu6 hydrolyzed p-nitrophenyl (pNP)-β-d-fucoside (k_cat/K_m = 67 mm⁻¹ s⁻¹), pNP-β-d-glucoside (k_cat/K_m = 6.2 mm⁻¹ s⁻¹), and pNP-β-d-galactoside (k_cat/K_m = 1.6 mm⁻¹s⁻¹) efficiently but had little activity toward other pNP glycosides. It also had high activity toward n-octyl-β-d-glucoside and β-(1→3)- and β-(1→2)-linked disaccharides and was able to hydrolyze apigenin β-glucoside and several other natural glycosides. Crystal structures of Os3BGlu6 and its complexes with a covalent intermediate, 2-deoxy-2-fluoroglucoside, and a nonhydrolyzable substrate analog, n-octyl-β-d-thioglucopyranoside, were solved at 1.83, 1.81, and 1.80 Å resolution, respectively. The position of the covalently trapped 2-F-glucosyl residue in the enzyme was similar to that in a 2-F-glucosyl intermediate complex of Os3BGlu7 (rice BGlu1). The side chain of methionine-251 in the mouth of the active site appeared to block the binding of extended β-(1→4)-linked oligosaccharides and interact with the hydrophobic aglycone of n-octyl-β-d-thioglucopyranoside. This correlates with the preference of Os3BGlu6 for short oligosaccharides and hydrophobic glycosides.β-Glucosidases (EC 3.2.1.21) have a wide range of functions in plants, including acting in cell wall remodeling, lignification, chemical defense, plant-microbe interactions, phytohormone activation, activation of metabolic intermediates, and release of volatiles from their glycosides (Esen, 1993). They fulfill these roles by hydrolyzing the glycosidic bond at the nonreducing terminal glucosyl residue of a glycoside or an oligosaccharide, thereby releasing Glc and an aglycone or a shortened carbohydrate. The aglycone released from the glycoside may be a monolignol, a toxic compound, or a compound that further reacts to release a toxic component, an active phytohormone, a reactive metabolic intermediate, or a volatile scent compound (Brzobohatý et al., 1993; Dharmawardhama et al., 1995; Reuveni et al., 1999; Lee et al., 2006; Barleben et al., 2007; Morant et al., 2008). Indeed, the wide range of glucosides of undocumented functions found in plants suggests that many β-glucosidase functions may remain to be discovered.Plant β-glucosidases fall into related families that have been classified as glycosyl hydrolase (GH) families GH1, GH3, and GH5 (Henrissat, 1991; Coutinho and Henrissat, 1998, 1999). Of these, GH1 has been most thoroughly documented and shown to comprise a gene family encoding 40 putative functional GHs in Arabidopsis (Arabidopsis thaliana) and 34 in rice (Oryza sativa) in addition to a few pseudogenes (Xu et al., 2004; Opassiri et al., 2006). In addition to β-glucosidases, plant GH1 members include β-mannosidases (Mo and Bewley, 2002), β-thioglucosidases (Burmeister et al., 1997), and disaccharidases such as primeverosidase (Mizutani et al., 2002) as well as hydroxyisourate hydrolase, which hydrolyzes the internal bond in a purine ring rather than a glycosidic bond (Raychaudhuri and Tipton, 2002). The specificity for the glycone in GH1 enzymes varies. Some enzymes are quite specific for β-d-glucosides or β-d-mannosides, while many accept either β-d-glucosides or β-d-fucosides, and some also hydrolyze β-d-galactosides, β-d-xylosides, and α-l-arabinoside (Esen, 1993). However, most GH1 enzymes are thought to hydrolyze glucosides in the plant, and it is the aglycone specificity that determines the functions of most GH1 enzymes.Aglycone specificity of GH1 β-glucosidases ranges from rather broad to absolutely specific for one substrate and is not obvious from sequence similarity. For instance, maize (Zea mays) ZmGlu1 β-glucosidase hydrolyzes a range of glycosides, including its natural substrate, 2-O-β-d-glucopyranosyl-4-dihydroxy-1,4-benzoxazin-3-one (DIMBOAGlc), but not dhurrin, whereas sorghum (Sorghum bicolor) Dhr1, which is 72% identical to ZmGlu1, only hydrolyzes its natural cyanogenic substrate dhurrin (Verdoucq et al., 2003). Similarly, despite sharing over 80% amino acid sequence identity, the legume isoflavonoid β-glucosidases dalcochinase from Dalbergia cochinchinensis and Dnbglu2 from Dalbergia nigrescens hydrolyze each other''s natural substrate very poorly (Chuankhayan et al., 2007). Thus, small differences in the amino acid sequence surrounding the active site may be expected to account for significant differences in substrate specificity.GH1 is classified in GH clan A, which consists of GH families whose members have a (β/α)₈-barrel structure with the catalytic acid/base on strand 4 of the β-barrel and the catalytic nucleophile on strand 7 (Henrissat et al., 1995; Jenkins et al., 1995). As such, all GH1 enzymes have similar overall structures, but it has been noted that four variable loops at the C-terminal end of the β-barrel strands, designated A, B, C, and D, account for much of the differences in the active site architecture (Sanz-Aparicio et al., 1998). The similar structures with great diversity in substrate specificity make plant GH1 enzymes an ideal model system to investigate the structural basis of substrate specificity. To date, seven plant β-glucosidase structures have been reported, including three closely related chloroplastic enzymes from maize (Czjzek et al., 2000, 2001), sorghum (Verdoucq et al., 2004), and wheat (Triticum aestivum; Sue et al., 2006), the cytoplasmic strictosidine β-glucosidase from Rauvolfia serpentine (Barleben et al., 2007), and the secreted enzymes white clover (Trifolium repens) cyanogenic β-glucosidase (Barrett et al., 1995), white mustard (Sinapsis alba) myrosinase (thioglucosidase; Burmeister et al., 1997), and rice Os3BGlu7 (BGlu1; Chuenchor et al., 2008). These enzymes hydrolyze substrates with a range of structures, but they cannot account for the full range of β-glucosidase substrates available in plants, and determining the structural differences that bring about substrate specificity differences in even closely related GH1 enzymes has proven tricky (Verdoucq et al., 2003, 2004; Sue et al., 2006; Chuenchor et al., 2008).Amino acid sequence-based phylogenetic analysis of GH1 enzymes encoded by the rice genome showed that there are eight clusters containing both rice and Arabidopsis proteins that are more closely related to each other than they are to enzymes from the same plants outside the clusters (Fig. 1; Opassiri et al., 2006). In addition, there are a cluster of sixteen putative β-glucosidases and a cluster of myrosinases in Arabidopsis without any closely related rice counterparts. Comparison with characterized GH1 enzymes from other plants reveals other clusters of related enzymes not found in rice or Arabidopsis, including the chloroplastic enzymes, from which the maize, sorghum, and wheat structures are derived, and the cytoplasmic metabolic enzymes, from with the strictosidine hydrolase structure is derived (Fig. 1). Therefore, although the known structures provide good tools for molecular modeling of plant enzymes, most rice and Arabidopsis GH1 enzymes lack a close correspondence in sequence and functional evolution to these structures, suggesting that the variable loops that determine the active site may be different. It would be useful, therefore, to know the structures and substrate specificities of representative members of each of the eight clusters seen in rice and Arabidopsis. To begin to acquire this information, we have expressed Os3BGlu6, a member of cluster At/Os 1 in Figure 1, characterized its substrate specificity, and determined its structure alone and in complex with a glycosyl intermediate and a nonhydrolyzable substrate analog.Open in a separate windowFigure 1.Simplified phylogenetic tree of the amino acid sequences of eukaryotic GH1 proteins with known structures and those of rice and Arabidopsis GH1 gene products. The protein sequences of the eukaryotic proteins with known structures are marked with four-character PDB codes for one of their structures, including Trifolium repens cyanogenic β-glucosidase (1CBG; Barrett et al., 1995), Sinapsis alba myrosinase (1MYR; Burmeister et al., 1997), Zea mays ZmGlu1 β-glucosidase (1E1F; Czjzek et al., 2000), Sorghum bicolor Dhr1 dhurrinase (1V02; Verdoucq et al., 2004), Triticum aestivum β-glucosidase (2DGA; Sue et al., 2006), Rauvolfia serpentina strictosidine β-glucosidase (2JF6; Barleben et al., 2007), and Oryza sativa Os3BGlu7 (BGlu1) β-glucosidase (2RGL; Chuenchor et al., 2008) from plants, along with Brevicoryne brassicae myrosinase (1WCG; Husebye et al., 2005), Homo sapiens cytoplasmic (Klotho) β-glucosidase (2E9M; Hayashi et al., 2007), and Phanerochaete chrysosporium (2E3Z; Nijikken et al., 2007), while those encoded in the Arabidopsis and rice genomes are labeled with the systematic names given by Xu et al. (2004) and Opassiri et al. (2006), respectively. One or two example proteins from each plant are given for each of the eight clusters of genes shared by Arabidopsis (At) and rice (Os) and the Arabidopsis-specific clusters At I (β-glucosidases) and At II (myrosinases), with the number of Arabidopsis or rice enzymes in each cluster given in parentheses. These sequences were aligned with all of the Arabidopsis and rice sequences in ClustalX (Thompson et al., 1997), the alignment was manually edited, all but representative sequences were removed, and the tree was calculated by the neighbor-joining method, bootstrapped with 1,000 trials, and then drawn with TreeView (Page, 1996). The grass plastid β-glucosidases, which are not represented in Arabidopsis and rice, are shown in the group marked “Plastid.” Percentage bootstrap reproducibility values are shown on internal branches where they are greater than 60%. Except those marked by asterisks, all external branches represent groups with 100% bootstrap reproducibility. To avoid excess complexity, those groups of sequences marked with asterisks are not monophyletic and represent more branches within the designated cluster than are shown. For a complete phylogenetic analysis of Arabidopsis and rice GH1 proteins, see Opassiri et al. (2006).     

Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays

A comparative analysis of gene expression profiles during cold acclimation and deacclimation is necessary to elucidate the molecular mechanisms of cold stress responses in higher plants. We analyzed gene expression profiles in the process of cold acclimation and deacclimation (recovery from cold stress) using two microarray systems, the 7K RAFL cDNA microarray and the Agilent 22K oligonucleotide array. By both microarray analyses, we identified 292 genes up-regulated and 320 genes down-regulated during deacclimation, and 445 cold up-regulated genes and 341 cold down-regulated genes during cold acclimation. Many genes up-regulated during deacclimation were found to be down-regulated during cold acclimation, and vice versa. The genes up-regulated during deacclimation were classified into (1) regulatory proteins involved in further regulation of signal transduction and gene expression and (2) functional proteins involved in the recovery process from cold-stress-induced damages and plant growth. We also applied expression profiling studies to identify the key genes involved in the biosynthesis of carbohydrates and amino acids that are known to play important roles in cold acclimation. We compared genes that are regulated during deacclimation with those regulated during rehydration after dehydration to discuss the similarity and difference of each recovery process.Electronic Supplementary Material Supplementary materials are available for this article at     

A novel enzymatic process for glycogen production

Two well-established methods to prepare glycogen are available: (1) extraction from natural resources such as shellfish and animal tissues; (2) synthesis from glucose-1-phosphate using two enzymes, α-glucan phosphorylase (EC 2.4.1.1) and branching enzyme (EC 2.4.1.18). We have developed a novel enzymatic process for glycogen production, in which short-chain amylose is first prepared from starch or dextrin by using isoamylase (EC 3.2.1.68), and then branching enzyme and amylomaltase (EC 2.4.1.25) are added to synthesize glycogen. Our enzymatic process, using isoamylase, branching enzyme and amylomaltase, is currently the most efficient for glycogen production. Furthermore, the molecular weight of glycogen is controllable in a range of 3.0×10⁶ to 3.0×10⁷ by adjusting some parameters of the reaction.     

Effects of Hypoxia on the Activity of the Dopaminergic Neuron System in the Rat Striatum as Studied by In Vivo Brain Microdialysis

The purpose of the present study is to clarify the effects of hypoxia on the activity of the dopaminergic neurons in the brain and its mechanism of action. For this purpose, the effects of hypoxia on the extracellular levels of 3,4-dihy-droxyphenylethylamine (dopamine) were examined in the rat Striatum using in vivo brain microdialysis in the presence or absence of pretreatment with either tetrodotoxin (a blocker of voltage-dependent sodium channels) or nomifensine (a blocker of dopamine reuptake). Exposure to various degrees of hypoxia (15, 10, and 8% O₂ in N₂) increased dopamine levels in striatal dialysates to 200, 400, and 1,100%, respectively, of the control value. On reoxygenation, dopamine levels in the dialysates rapidly returned to the control level. Reexposure to hypoxia increased the dopamine levels to the same extent as during the first exposure. After addition of tetrodotoxin (40 mUM) to the perfusion fluid or pretreatment with nomifensine (100 mg/kg, i.p.), exposure to hypoxia no longer increased the dopamine levels. These results suggest that although hypoxia induces an increase in the extracellular dopamine levels (hence, an apparent increase in the activity of the dopaminergic neurons), this increase is not the result of an increase in dopamine release itself, but rather the result of inhibition of the dopamine reuptake mechanism.