Circumvention of chaperone requirement for aggregate formation of a short polyglutamine tract by the co-expression of a long polyglutamine tract

Polyglutamine disease is now recognized as one of the conformational, amyloid-related diseases. In this disease, polyglutamine expansion in proteins has toxic effects on cells and also results in the formation of aggregates. Polyglutamine aggregate formation is accompanied by conversion of the polyglutamine from a soluble to an insoluble form. In yeast, the efficiency of the aggregate formation is determined by the balance of various parameters, including the length of the polyglutamine tract, the function of Hsp104, and the level of polyglutamine expression. In this study, we found that the co-expression of a long polyglutamine tract, which formed aggregates independently of the function of Hsp104, enhanced the formation of aggregates of a short polyglutamine tract in wild-type cells as well as in Deltahsp104 mutant cells. Thus, the expression of a long polyglutamine tract would be an additional parameter determining the efficiency of aggregate formation of a short polyglutamine tract. The co-localization of aggregates of long and short polyglutamine tracts suggests the possibility that the enhancement occurs due to the seeding of aggregates of the long polyglutamine tracts.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Affinity selection of DNA-binding proteins from yeast genomic DNA libraries by improved lambda phage display vector

Phage display is a useful means of identifying and selecting proteins of interest that bind specific targets. In order to examine the potential of phage display for the genome-wide screening of DNA-binding proteins, we constructed yeast genomic libraries using lambda foo-based vectors devised in this work. After affinity selection using GAL4 UAS(G) as a probe, phages expressing GAL4 were enriched approximately 5 x 10(5)-fold from the library. Approximately 90% of polypeptides encoded in correct translation reading frames by the selected phages were known or putative polynucleotide-binding proteins. This result clearly indicates that the modified lambda phage display vector in combination with our enrichment technique has great potential for the enrichment of DNA-binding proteins in a sequence-specific manner.     

Gene expression pattern analysis of the tight junction protein, Claudin, in the early morphogenesis of Xenopus embryos

To study how epithelial layers are formed during early development in Xenopus embryos, we have focused on Claudin, the major component of the tight junction. So far, 19 claudin genes have been found in the mouse, expressed in different epithelial tissues. However, though a number of cytological studies have been done for the roles of Claudins, their expression patterns and functions during early embryogenesis are largely unknown. We found three novel Xenopus claudin genes, which are referred to as claudin-4L1, -4L2, and -7L1. At the early gastrula stage, claudin-4L1, -4L2, and -7L1 mRNAs were detected in the ectoderm and in the mesoderm. At the late gastrula stage, claudin mRNAs were detected in the ectoderm through the involuting archenteron roof. At the neurula stage, claudin-4L1/4L2 and -7L1 mRNAs were differentially expressed in the neural groove and the epidermal ectoderm. At the tailbud stage, the claudin mRNAs were found in the branchial arches, the otic vesicles, the sensorial layer of the epidermis, and along the dorsal midline of the neural tube. In addition, claudin-4L1/4L2 mRNAs were detected in the pronephros and the endoderm, whereas claudin-7L1 mRNA was observed in the epithelial layer of the epidermis.     

Functional vanilloid receptors in cultured normal human epidermal keratinocytes

Vanilloid receptor subtype 1, VR1, is an ion channel that serves as a polymodal detector of pain-producing chemicals such as capsaicin and protons in primary afferent neurons. Here we showed that both capsaicin and acidification produced elevations in the intracellular Ca(2+) concentration ([Ca(2+)](i)) in cultured human epidermal keratinocytes. The capsaicin- and acidification-evoked increases in [Ca(2+)](i) were inhibited by capsazepine, an antagonist to VR1. VR1-like immunoreactivity was observed in the cells. These findings suggest that functional VR1-like protein is present and functions as a sensor against noxious chemical stimuli, such as capsaicin or acidification, in epidermal keratinocytes.     

Evaluation of a mass screening program for lysinuric protein intolerance in the northern part of Japan

Lysinuric protein intolerance (LPI:MIM 222700) is an autosomal recessive disease characterized by defective transport of the dibasic amino acids. We recently reported a local cluster of LPI in the northern part of Japan (Koizumi et al., 2000). Mutational analysis of the LPI patients in this local cluster revealed they were exclusively homozygous for the R410X mutation. The effectiveness of early intervention with citrulline therapy (200 mg/kg per day) and protein restriction (1.5 g/kg per day) was confirmed in these patients. Mass screening was conducted in 4,568 newborn babies between 1999 and 2002, which was estimated to cover 100% of almost all newborns delivered in the screened area. Forty heterozygous newborns were found (0.88%), leading to an estimated incidence of LPI of 1:51,984. The number of people that required screening to detect one case was 51,984, and the cost for mass screening was 30 cents/person (a total of dollars 15,600). This is comparable to, or even less than, the cost of currently screened diseases in Japan. Therefore, we conclude that a mass screening program for LPI can be introduced effectively and economically into an area where an LPI cluster is located as the result of a founder mutation.     

Localization of sepiapterin reductase in pigment cells of Oryzias latipes

Body colors of poikilothermal vertebrates are derived from three distinct types of pigment cells, melanophores, erythro/xanthophores and irido/leucophores. It is well known that melanin in melanophores is synthesized by tyrosinase within a specific organelle termed the melanosome. Although sepiapterin reductase (SPR) is an important enzyme involved in metabolizing biopterin and sepiapterin (a conspicuous pteridine as a coloring pigment in xanthophores) the distribution of SPR has not been shown in pigment cells. An antibody raised in rabbits against rat SPR was used to demonstrate the presence of SPR in pigment cells of Oryzias latipes. This study, which used immunohistochemistry with fluorescence or peroxidase/diaminobenzidine as markers, revealed that SPR could be detected readily in xanthophores, but only faintly in melanophores. These results suggest that sepiapterin is metabolized within xanthophores. Moreover, these experiments show that a protein sharing immunological cross-reactivity with rat SPR is located in teleost O. latipes xanthophores, which is significant considering the relationship of pteridine metabolism between poikilothermal vertebrates and mammals. Further progress in investigations of the roles of pteridines in vertebrates will be promoted by using these fish which can be bred in mass rather easily in the laboratory.     

Activation and Functional Analysis of Janus Kinase 2 in BA/F3 Cells Using the Coumermycin/Gyrase B System

Janus kinase 2 (Jak2) protein tyrosine kinase plays an important role in interleukin-3– or granulocyte–macrophage colony-stimulating factor–mediated signal transduction pathways leading to cell proliferation, activation of early response genes, and inhibition of apoptosis. However, it is unclear whether Jak2 can activate these signaling pathways directly without the involvement of cytokine receptor phosphorylation. To investigate the specific role of Jak2 in the regulation of signal transduction pathways, we generated gyrase B (GyrB)–Jak2 fusion proteins, dimerized through the addition of coumermycin. Coumermycin induced autophosphorylation of GyrB–Jak2 fusion proteins, thus bypassing receptor activation. Using different types of chimeric Jak2 molecules, we observed that although the kinase domain of Jak2 is sufficient for autophosphorylation, the N-terminal regions are essential for the phosphorylation of Stat5 and for the induction of short-term cell proliferation. Moreover, coumermycin-induced activation of Jak2 can also lead to increased levels of c-myc and CIS mRNAs in BA/F3 cells stably expressing the Jak2 fusion protein with the intact N-terminal region. Conversely, activation of the chimeric Jak2 induced neither phosphorylation of Shc or SHP-2 nor activation of the c-fos promoter. Here, we showed that the GyrB–Jak2 system can serve as an excellent model to dissect signals of receptor-dependent and -independent events. We also obtained evidence indicating a role for the N-terminal region of Jak2 in downstream signaling events.     

Identification of Osteopontin as a Novel Ligand for the Integrin α8β1 and Potential Roles for This Integrin–Ligand Interaction in Kidney Morphogenesis

Epithelio–mesenchymal interactions during kidney organogenesis are disrupted in integrin α8β1-deficient mice. However, the known ligands for integrin α8β1—fibronectin, vitronectin, and tenascin-C—are not appropriately localized to mediate all α8β1 functions in the kidney. Using a method of general utility for determining the distribution of unknown integrin ligands in situ and biochemical characterization of these ligands, we identified osteopontin (OPN) as a ligand for α8β1. We have coexpressed the extracellular domains of the mouse α8 and β1 integrin subunits as a soluble heterodimer with one subunit fused to alkaline phosphatase (AP) and have used the α8β1-AP chimera as a histochemical reagent on sections of mouse embryos. Ligand localization with α8β1-AP in developing bone and kidney was observed to be overlapping with the distribution of OPN. In “far Western” blots of mouse embryonic protein extracts, bands were detected with sizes corresponding to fibronectin, vitronectin, and unknown proteins, one of which was identical to the size of OPN. In a solid-phase binding assay we demonstrated that purified OPN binds specifically to α8β1-AP. Cell adhesion assays using K562 cells expressing α8β1 were used to confirm this result. Together with a recent report that anti-OPN antibodies disrupt kidney morphogenesis, our results suggest that interactions between OPN and integrin α8β1 may help regulate kidney development and other morphogenetic processes.