Gene expression profiles of endothelial progenitor cells by oligonucleotide microarray analysis

Among the many tissue stem or progenitor cells recently being unveiled, endothelial progenitor cells (EPCs) have attracted particular attention, not only because of their cardinal role in vascular biology and embryology but also because of their potential use in the therapeutic development of a variety of postnatal diseases, including cardiovascular and peripheral vascular disorders and cancer. The aim of this study is to provide some basic and comprehensive information on gene expression of EPCs to characterize the cells in molecular terms. Here, we focus on EPCs derived from CD34-positive mononuclear cells of human umbilical cord blood. The EPCs were purified and expanded in culture and analyzed by a high-density oligonucleotide microarray and real-time RT-PCR analysis. We identified 169 up-regulated and 107 down-regulated genes in the EPCs compared with three differentiated endothelial cells of human umbilical vein endothelial cells (HUVEC), human lung microvascular endothelial cells (LMEC) and human aortic endothelial cells (AoEC). It is expected that the obtained list include key genes which are critical for EPC function and survival and thus potential targets of EPC recognition in vivo and therapeutic modulation of vasculogenesis in cancer as well as other diseases, in which de novo vasculogenesis plays a crucial role. For instance, the list includes Syk and galectin-3, which encode protein tyrosine kinase and β-galactoside-binding protein, respectively, and are expressed higher in EPCs than the three control endothelial cells. In situ hybridization showed that the genes were expressed in isolated cells in the fetal liver at E11.5 and E14.5 of mouse development.     

Flowering and Endogenous Levels of Plant Hormones in Lemna Species

The occurrence and endogenous level of various plant hormoneswere measured for the short-day plants Lemna paucicostata 151and 381 and the long-day plant Lemna gibba G3 to determine whetherany of them are involved in the photoperiodic control of flowering.ABA, IAA, GA₁, GA₂₉, GA₃₄, GA₅₃, trans- and cis-zeatin, trans-and cis-ribosyl zeatin, N⁶-(²-isopentenyl) adenine and N⁶-(²-isopentenyl)adenosine were definitely detected in each species, while GA₄was only detected in L. gibba G3 and GA₂₀ was only detectedin L. paucicostata 151. The endogenous levels of ABA and IAAwere in the range of 1–7 ng/g fr wt and were not significantlydifferent in vegetative and flowering plants. The endogenousgibberellin levels were generally higher in Lemna grown underlong-day rather than short-day conditions. The endogenous cytokininlevels were almost the same in both flowering and vegetativeplants of L. paucicostata 151 and 381. In L. gibba G3, however,the level of cis-ribosyl zeatin, N⁶-(²-isopentenyl) adenineand N⁶-(²-sopentenyl) adenosine were higher in vegetative thanin flowering plants. These results indicate that there is not necessarily a directrelation between endogenous plant hormone levels and flowering,and that the chemical basis for the photoperiodic control offlowering cannot be explained solely by changes in hormone levels.The possibility remains, however, that one or more of the planthormones has some influence of secondary importance on the floweringprocess in Lemna. (Received January 29, 1986; Accepted July 12, 1986)     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Pkn9, a Ser/Thr protein kinase involved in the development of Myxococcus xanthus

The Myxococcus xanthus gene, pkn9 , encodes a protein that contains significant homology with eukaryotic Ser/Thr protein kinases. The pkn9 gene was singled out of a previously identified family of kinase genes by amplification techniques that displayed differences in kinase gene expression during selected periods of the M. xanthus life cycle. Pkn9 was constitutively expressed during vegetative growth and upregulated during the aggregation stage of early development. It consists of 589 amino acids, and its N-terminal 394 residues show 38% identity with both Pkn1 and Pkn2 of M. xanthus . This region also shows 29, 25 and 29% identity with myosin light-chain kinase, protein kinase C, and cAMP-dependent protein kinase, respectively. A 22-residue hydrophobic transmembrane domain separates the kinase domain from the 173-residue C-terminal domain that resides on the outside of the inner membrane. The C-terminal domain contains two sets of tandem repeats of 13 and 10 residues which have no known function. When expressed in Escherichia coli under the T7 promoter, Pkn9 was found to be phosphorylated on serine and threonine residues. Disruption of the pkn9 kinase catalytic subdomains I–III by the insertion of a kanamycin-resistance gene resulted in slightly delayed, smaller and more-crowded fruiting bodies, while spore formation was normal. Total deletion of the pkn9 gene caused severely reduced progression through development resulting in light loose mounds that become slightly more compact over time. Development progressed further at the centre than at the edge of the spot, and spore formation was significantly reduced. Two-dimensional gel analysis revealed that both the disruption and the deletion of pkn9 prevented the expression of five membrane proteins (KREP9-1-4). These results suggest that the loss of Pkn9 kinase activity caused altered fruiting-body formation, the absence of the KREP9 proteins in the membrane, and reduced spore production.     

Localization of sepiapterin reductase in pigment cells of Oryzias latipes

Body colors of poikilothermal vertebrates are derived from three distinct types of pigment cells, melanophores, erythro/xanthophores and irido/leucophores. It is well known that melanin in melanophores is synthesized by tyrosinase within a specific organelle termed the melanosome. Although sepiapterin reductase (SPR) is an important enzyme involved in metabolizing biopterin and sepiapterin (a conspicuous pteridine as a coloring pigment in xanthophores) the distribution of SPR has not been shown in pigment cells. An antibody raised in rabbits against rat SPR was used to demonstrate the presence of SPR in pigment cells of Oryzias latipes. This study, which used immunohistochemistry with fluorescence or peroxidase/diaminobenzidine as markers, revealed that SPR could be detected readily in xanthophores, but only faintly in melanophores. These results suggest that sepiapterin is metabolized within xanthophores. Moreover, these experiments show that a protein sharing immunological cross-reactivity with rat SPR is located in teleost O. latipes xanthophores, which is significant considering the relationship of pteridine metabolism between poikilothermal vertebrates and mammals. Further progress in investigations of the roles of pteridines in vertebrates will be promoted by using these fish which can be bred in mass rather easily in the laboratory.     

Inferences of evolutionary history of a widely distributed mangrove species,Bruguiera gymnorrhiza,in the Indo‐West Pacific region

Inference of genetic structure and demographic history is fundamental issue in evolutionary biology. We examined the levels and patterns of genetic variation of a widespread mangrove species in the Indo‐West Pacific region, Bruguiera gymnorrhiza, using ten nuclear gene regions. Genetic variation of individual populations covering its distribution range was low, but as the entire species it was comparable to other plant species. Genetic differentiation among the investigated populations was high. They could be divided into two genetic clusters: the West and East clusters of the Malay Peninsula. Our results indicated that these two genetic clusters derived from their ancestral population whose effective size of which was much larger compared to the two extant clusters. The point estimate of speciation time between B. gymnorrhiza and Bruguiera sexangula was two times older than that of divergence time between the two clusters. Migration from the West cluster to the East cluster was much higher than the opposite direction but both estimated migration rates were low. The past Sundaland and/or the present Malay Peninsula are likely to prevent gene flow between the West and East clusters and function as a geographical or land barrier.     

Significance of 12S Toxin of Clostridium botulinum Type E

The pathogenesis of type E botulism is discussed as an aspect of the physicochemical and biological properties of 12S toxins (prototoxin and trypsin-activated 12S toxin) and the Ealpha and Ebeta components of each 12S toxin. A molecular weight of 350,000 was determined for each 12S toxin and 150,000 for Ealpha and Ebeta. Owing to the structure comprising the subunits Ealpha and Ebeta, 12S toxins are much more stable than Ealpha at low pH values and high temperatures. Such was also the case with type A 19S toxin and its alpha component. The Ealpha component alone accounts for the total toxicity of type E toxin. The toxic substance detected in the blood of the animals administered 12S toxins orally or parenterally was identified as Ealpha from the molecular size and the chromatographic pattern. Prototoxin escaping from detoxification in the stomach owing to the subunit structure may undergo dissociation in the intestine to release the Ealpha component. After absorption, the activated Ealpha appeared in the circulating blood without any further signs of dissociation or enzymatic digestion.     

Demonstration of light-induced potential change in Chara cells lacking tonoplast

Chara cells without tonoplasts, prepared by replacing the cellsap with EGTA-containing media, showed essentially the samepattern of light-induced changes in membrane potential and membraneresistance as normal cells although the concentrations of ionsand ATP in the cytoplasm decreased considerably (1/3–1/10)after loss of the tonoplast. Removal of the tonoplast reducedthe rate of photosynthetic O₂ evolution to about 50% of thatof normal cells but did not affect the magnitude of light-inducedpotential change. Not a full but a certain level of electronflow seems necessary to activate the putative electrogenic H⁺-pump. ¹ Present address: Department of Botany, Faculty of Science,University of Tokyo, Japan. ² Present address: Niigata College of Pharmacy, Niigata 950-21,Japan. (Received September 4, 1978; )