Gene expression profiles of endothelial progenitor cells by oligonucleotide microarray analysis

Among the many tissue stem or progenitor cells recently being unveiled, endothelial progenitor cells (EPCs) have attracted particular attention, not only because of their cardinal role in vascular biology and embryology but also because of their potential use in the therapeutic development of a variety of postnatal diseases, including cardiovascular and peripheral vascular disorders and cancer. The aim of this study is to provide some basic and comprehensive information on gene expression of EPCs to characterize the cells in molecular terms. Here, we focus on EPCs derived from CD34-positive mononuclear cells of human umbilical cord blood. The EPCs were purified and expanded in culture and analyzed by a high-density oligonucleotide microarray and real-time RT-PCR analysis. We identified 169 up-regulated and 107 down-regulated genes in the EPCs compared with three differentiated endothelial cells of human umbilical vein endothelial cells (HUVEC), human lung microvascular endothelial cells (LMEC) and human aortic endothelial cells (AoEC). It is expected that the obtained list include key genes which are critical for EPC function and survival and thus potential targets of EPC recognition in vivo and therapeutic modulation of vasculogenesis in cancer as well as other diseases, in which de novo vasculogenesis plays a crucial role. For instance, the list includes Syk and galectin-3, which encode protein tyrosine kinase and β-galactoside-binding protein, respectively, and are expressed higher in EPCs than the three control endothelial cells. In situ hybridization showed that the genes were expressed in isolated cells in the fetal liver at E11.5 and E14.5 of mouse development.     

Pkn9, a Ser/Thr protein kinase involved in the development of Myxococcus xanthus

The Myxococcus xanthus gene, pkn9 , encodes a protein that contains significant homology with eukaryotic Ser/Thr protein kinases. The pkn9 gene was singled out of a previously identified family of kinase genes by amplification techniques that displayed differences in kinase gene expression during selected periods of the M. xanthus life cycle. Pkn9 was constitutively expressed during vegetative growth and upregulated during the aggregation stage of early development. It consists of 589 amino acids, and its N-terminal 394 residues show 38% identity with both Pkn1 and Pkn2 of M. xanthus . This region also shows 29, 25 and 29% identity with myosin light-chain kinase, protein kinase C, and cAMP-dependent protein kinase, respectively. A 22-residue hydrophobic transmembrane domain separates the kinase domain from the 173-residue C-terminal domain that resides on the outside of the inner membrane. The C-terminal domain contains two sets of tandem repeats of 13 and 10 residues which have no known function. When expressed in Escherichia coli under the T7 promoter, Pkn9 was found to be phosphorylated on serine and threonine residues. Disruption of the pkn9 kinase catalytic subdomains I–III by the insertion of a kanamycin-resistance gene resulted in slightly delayed, smaller and more-crowded fruiting bodies, while spore formation was normal. Total deletion of the pkn9 gene caused severely reduced progression through development resulting in light loose mounds that become slightly more compact over time. Development progressed further at the centre than at the edge of the spot, and spore formation was significantly reduced. Two-dimensional gel analysis revealed that both the disruption and the deletion of pkn9 prevented the expression of five membrane proteins (KREP9-1-4). These results suggest that the loss of Pkn9 kinase activity caused altered fruiting-body formation, the absence of the KREP9 proteins in the membrane, and reduced spore production.     

Flowering and Endogenous Levels of Plant Hormones in Lemna Species

The occurrence and endogenous level of various plant hormoneswere measured for the short-day plants Lemna paucicostata 151and 381 and the long-day plant Lemna gibba G3 to determine whetherany of them are involved in the photoperiodic control of flowering.ABA, IAA, GA₁, GA₂₉, GA₃₄, GA₅₃, trans- and cis-zeatin, trans-and cis-ribosyl zeatin, N⁶-(²-isopentenyl) adenine and N⁶-(²-isopentenyl)adenosine were definitely detected in each species, while GA₄was only detected in L. gibba G3 and GA₂₀ was only detectedin L. paucicostata 151. The endogenous levels of ABA and IAAwere in the range of 1–7 ng/g fr wt and were not significantlydifferent in vegetative and flowering plants. The endogenousgibberellin levels were generally higher in Lemna grown underlong-day rather than short-day conditions. The endogenous cytokininlevels were almost the same in both flowering and vegetativeplants of L. paucicostata 151 and 381. In L. gibba G3, however,the level of cis-ribosyl zeatin, N⁶-(²-isopentenyl) adenineand N⁶-(²-sopentenyl) adenosine were higher in vegetative thanin flowering plants. These results indicate that there is not necessarily a directrelation between endogenous plant hormone levels and flowering,and that the chemical basis for the photoperiodic control offlowering cannot be explained solely by changes in hormone levels.The possibility remains, however, that one or more of the planthormones has some influence of secondary importance on the floweringprocess in Lemna. (Received January 29, 1986; Accepted July 12, 1986)     

Significance of 12S Toxin of Clostridium botulinum Type E

The pathogenesis of type E botulism is discussed as an aspect of the physicochemical and biological properties of 12S toxins (prototoxin and trypsin-activated 12S toxin) and the Ealpha and Ebeta components of each 12S toxin. A molecular weight of 350,000 was determined for each 12S toxin and 150,000 for Ealpha and Ebeta. Owing to the structure comprising the subunits Ealpha and Ebeta, 12S toxins are much more stable than Ealpha at low pH values and high temperatures. Such was also the case with type A 19S toxin and its alpha component. The Ealpha component alone accounts for the total toxicity of type E toxin. The toxic substance detected in the blood of the animals administered 12S toxins orally or parenterally was identified as Ealpha from the molecular size and the chromatographic pattern. Prototoxin escaping from detoxification in the stomach owing to the subunit structure may undergo dissociation in the intestine to release the Ealpha component. After absorption, the activated Ealpha appeared in the circulating blood without any further signs of dissociation or enzymatic digestion.     

Influence of physicochemical properties of rice flour on oil uptake of tempura frying batter

The physicochemical properties of rice flour and wheat flour influenced the oil uptake of tempura frying batter. Rice flour was better than wheat flour in the overall quality and crispness of the fried tempura batter. Rice flour resisted oil absorption more than wheat flour, and a higher level of apparent starch amylose and higher consistency/breakdown ratio of the pasting properties led to a lower oil uptake of the batter. Super hard EM10 rice showed the highest apparent amylose content and higher consistency/breakdown ratio than the other flour samples, the batter from EM10 revealing the lowest oil content after frying among all the batters examined. The apparent amylose content, consistency/breakdown ratio and oil absorption index are proposed as useful guides for oil absorption when frying from among the physicochemical properties that influence the oil content of fried batter. Our proposal for the "oil absorption index" could be a simple, although not perfect method for estimating the oil content of batter flour.     

Techniques of SNP genotyping and remote sensing applied for elucidation of the contribution of polygene and environmental factors to inter-individual variation in skin pigmentation phenotype

We present a conceptual framework for applying techniques of SNP genotyping as a molecular biological approach and remote sensing as an ecological approach to elucidation of the contribution of polygene and environmental factors to inter-individual variation in skin pigmentation phenotype. Additionally, we discuss the obstacles that frustrate our efforts to identify how the human genome encodes the complex phenotype and suggest the use of computational methods designed for knowledge discovery within hereditary database.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Molecular mechanism of cell proliferation in rodent uterus during the estrous cycle

The rodent uterus is a widely studied target tissue for sexual steroid hormone action. The aim of the present study was to assess the molecular mechanism that participates in the initiation of cell proliferation of the rat uterine epithelial cells during the estrus (E)–metestrus (M) transition. Cell proliferation, ERα, c-fos, cyclin D1 and D3, cdk4, and cdk6 proteins were assessed in these animals by immunohistochemistry. Estradiol (E₂) and progesterone (P₄) plasma levels were assessed by RIA. The results indicate that the glandular epithelium starts to proliferate at 21:00 h on estrus day, and initiates at least 3 h before the luminal epithelium does. Fos expression was markedly increased during the afternoon of estrus day, and its increase was in parallel to ERα expression. Interestingly, both, cyclin D1 and D3 were abundantly expressed in the luminal and glandular epithelia, and nuclear immunolabelling of cyclin D1 and D3 precedes BrdU incorporation in the cell. cdk4 and cdk6 were localized in the nuclei in both epithelia throughout the studied time course. In addition, cdk4 was more abundant throughout estrus and metestrus days than cdk6. The overall results indicate that ERα, Fos and cyclins D1 and D3, cdk4 and cdk6 are expressed in both glandular and luminal epithelia of the rat uterus during the E–M transition. In conclusion, there is a good correlation between sequential expression of these proteins and cell cycle progression in the rat uterine epithelial cells during the estrous cycle. However, the differences observed in the cellular localization, time course of expression and the cellular types that express both cyclins between physiological and pharmacological conditions, demonstrated different mechanisms of regulation and should be due to the complex hormonal milieu during the estrous cycle.     

Formate production from methanol by formaldehyde dismutase coupled with a methanol oxidation system

Summary Formaldehyde dismutase was greatly stabilized by immobilization in a urethane prepolymer (PU-6). The immobilized enzyme exhibited stochiometrical dismutation of formaldehyde to methanol and formate in several repeated reactions. Conversion of methanol to formate occurred in a reaction with an immobilized enzyme system consisting of alcohol oxidase, catalase and formaldehyde dismutase, and with an intact cell-mixture of Hansenula polymorpha and Pseudomonas putida. Furthermore, the stability of the cell-mixture during repeated reactions was greatly improved by the immobilization, the 600 mM methanol added periodically being converted to formate in a 75% yield in 12 h. The immobilized cellsystem was also effective for the conversion of several aliphatic alcohols, C₁ to C₄, to the corresponding acids.