The TRPM7 ion channel functions in cholinergic synaptic vesicles and affects transmitter release

A longstanding hypothesis is that ion channels are present in the membranes of synaptic vesicles and might affect neurotransmitter release. Here we demonstrate that TRPM7, a member of the transient receptor potential (TRP) ion channel family, resides in the membrane of synaptic vesicles of sympathetic neurons, forms molecular complexes with the synaptic vesicle proteins synapsin I and synaptotagmin I, and directly interacts with synaptic vesicular snapin. In sympathetic neurons, changes in TRPM7 levels and channel activity alter acetylcholine release, as measured by EPSP amplitudes and decay times in postsynaptic neurons. TRPM7 affects EPSP quantal size, an intrinsic property of synaptic vesicle release. Targeted peptide interference of TRPM7's interaction with snapin affects the amplitudes and kinetics of postsynaptic EPSPs. Thus, vesicular TRPM7 channel activity is critical to neurotransmitter release in sympathetic neurons.     

Inferences of evolutionary history of a widely distributed mangrove species,Bruguiera gymnorrhiza,in the Indo‐West Pacific region

Inference of genetic structure and demographic history is fundamental issue in evolutionary biology. We examined the levels and patterns of genetic variation of a widespread mangrove species in the Indo‐West Pacific region, Bruguiera gymnorrhiza, using ten nuclear gene regions. Genetic variation of individual populations covering its distribution range was low, but as the entire species it was comparable to other plant species. Genetic differentiation among the investigated populations was high. They could be divided into two genetic clusters: the West and East clusters of the Malay Peninsula. Our results indicated that these two genetic clusters derived from their ancestral population whose effective size of which was much larger compared to the two extant clusters. The point estimate of speciation time between B. gymnorrhiza and Bruguiera sexangula was two times older than that of divergence time between the two clusters. Migration from the West cluster to the East cluster was much higher than the opposite direction but both estimated migration rates were low. The past Sundaland and/or the present Malay Peninsula are likely to prevent gene flow between the West and East clusters and function as a geographical or land barrier.     

Pkn9, a Ser/Thr protein kinase involved in the development of Myxococcus xanthus

The Myxococcus xanthus gene, pkn9 , encodes a protein that contains significant homology with eukaryotic Ser/Thr protein kinases. The pkn9 gene was singled out of a previously identified family of kinase genes by amplification techniques that displayed differences in kinase gene expression during selected periods of the M. xanthus life cycle. Pkn9 was constitutively expressed during vegetative growth and upregulated during the aggregation stage of early development. It consists of 589 amino acids, and its N-terminal 394 residues show 38% identity with both Pkn1 and Pkn2 of M. xanthus . This region also shows 29, 25 and 29% identity with myosin light-chain kinase, protein kinase C, and cAMP-dependent protein kinase, respectively. A 22-residue hydrophobic transmembrane domain separates the kinase domain from the 173-residue C-terminal domain that resides on the outside of the inner membrane. The C-terminal domain contains two sets of tandem repeats of 13 and 10 residues which have no known function. When expressed in Escherichia coli under the T7 promoter, Pkn9 was found to be phosphorylated on serine and threonine residues. Disruption of the pkn9 kinase catalytic subdomains I–III by the insertion of a kanamycin-resistance gene resulted in slightly delayed, smaller and more-crowded fruiting bodies, while spore formation was normal. Total deletion of the pkn9 gene caused severely reduced progression through development resulting in light loose mounds that become slightly more compact over time. Development progressed further at the centre than at the edge of the spot, and spore formation was significantly reduced. Two-dimensional gel analysis revealed that both the disruption and the deletion of pkn9 prevented the expression of five membrane proteins (KREP9-1-4). These results suggest that the loss of Pkn9 kinase activity caused altered fruiting-body formation, the absence of the KREP9 proteins in the membrane, and reduced spore production.     

Flowering and Endogenous Levels of Plant Hormones in Lemna Species

The occurrence and endogenous level of various plant hormoneswere measured for the short-day plants Lemna paucicostata 151and 381 and the long-day plant Lemna gibba G3 to determine whetherany of them are involved in the photoperiodic control of flowering.ABA, IAA, GA₁, GA₂₉, GA₃₄, GA₅₃, trans- and cis-zeatin, trans-and cis-ribosyl zeatin, N⁶-(²-isopentenyl) adenine and N⁶-(²-isopentenyl)adenosine were definitely detected in each species, while GA₄was only detected in L. gibba G3 and GA₂₀ was only detectedin L. paucicostata 151. The endogenous levels of ABA and IAAwere in the range of 1–7 ng/g fr wt and were not significantlydifferent in vegetative and flowering plants. The endogenousgibberellin levels were generally higher in Lemna grown underlong-day rather than short-day conditions. The endogenous cytokininlevels were almost the same in both flowering and vegetativeplants of L. paucicostata 151 and 381. In L. gibba G3, however,the level of cis-ribosyl zeatin, N⁶-(²-isopentenyl) adenineand N⁶-(²-sopentenyl) adenosine were higher in vegetative thanin flowering plants. These results indicate that there is not necessarily a directrelation between endogenous plant hormone levels and flowering,and that the chemical basis for the photoperiodic control offlowering cannot be explained solely by changes in hormone levels.The possibility remains, however, that one or more of the planthormones has some influence of secondary importance on the floweringprocess in Lemna. (Received January 29, 1986; Accepted July 12, 1986)     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Intracellular cholesterol mobilization involved in the ABCA1/apolipoprotein-mediated assembly of high density lipoprotein in fibroblasts

Differential regulation has been suggested for cellular cholesterol and phospholipid release mediated by apolipoprotein A-I (apoA-I)/ABCA1. We investigated various factors involved in cholesterol mobilization related to this pathway. ApoA-I induced a rapid decrease of the cellular cholesterol compartment that is in equilibrium with the ACAT-accessible pool in cells that generate cholesterol-rich HDL. Pharmacological and genetic inactivation of ACAT enhanced the apoA-I-mediated cholesterol release through upregulation of ABCA1 and through cholesterol enrichment in the HDL generated. Pharmacological activation of protein kinase C (PKC) also decreased the ACAT-accessible cholesterol pool, not only in the cells that produce cholesterol-rich HDL by apoA-I (i.e., human fibroblast WI-38 cells) but also in the cells that generate cholesterol-poor HDL (mouse fibroblast L929 cells). In L929 cells, the PKC activation caused an increase in apoA-I-mediated cholesterol release without detectable change in phospholipid release and in ABCA1 expression. These results indicate that apoA-I mobilizes intracellular cholesterol for the ABCA1-mediated release from the compartment that is under the control of ACAT. The cholesterol mobilization process is presumably related to PKC activation by apoA-I.     

Significance of 12S Toxin of Clostridium botulinum Type E

The pathogenesis of type E botulism is discussed as an aspect of the physicochemical and biological properties of 12S toxins (prototoxin and trypsin-activated 12S toxin) and the Ealpha and Ebeta components of each 12S toxin. A molecular weight of 350,000 was determined for each 12S toxin and 150,000 for Ealpha and Ebeta. Owing to the structure comprising the subunits Ealpha and Ebeta, 12S toxins are much more stable than Ealpha at low pH values and high temperatures. Such was also the case with type A 19S toxin and its alpha component. The Ealpha component alone accounts for the total toxicity of type E toxin. The toxic substance detected in the blood of the animals administered 12S toxins orally or parenterally was identified as Ealpha from the molecular size and the chromatographic pattern. Prototoxin escaping from detoxification in the stomach owing to the subunit structure may undergo dissociation in the intestine to release the Ealpha component. After absorption, the activated Ealpha appeared in the circulating blood without any further signs of dissociation or enzymatic digestion.     

Influence of physicochemical properties of rice flour on oil uptake of tempura frying batter

The physicochemical properties of rice flour and wheat flour influenced the oil uptake of tempura frying batter. Rice flour was better than wheat flour in the overall quality and crispness of the fried tempura batter. Rice flour resisted oil absorption more than wheat flour, and a higher level of apparent starch amylose and higher consistency/breakdown ratio of the pasting properties led to a lower oil uptake of the batter. Super hard EM10 rice showed the highest apparent amylose content and higher consistency/breakdown ratio than the other flour samples, the batter from EM10 revealing the lowest oil content after frying among all the batters examined. The apparent amylose content, consistency/breakdown ratio and oil absorption index are proposed as useful guides for oil absorption when frying from among the physicochemical properties that influence the oil content of fried batter. Our proposal for the "oil absorption index" could be a simple, although not perfect method for estimating the oil content of batter flour.