Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Phytohormone Priming: Regulator for Heavy Metal Stress in Plants

Phytohormones act as chemical messengers and, under a complex regulation, allow plants to sustain biotic and abiotic stresses. Thus, phytohormones are known for their regulatory role in plant growth and development. Heavy metals (HMs) play an important role in metabolism and have roles in plant growth and development as micronutrients. However, at a level above threshold, these HMs act as contaminants and pose a worldwide environmental threat. Thus, finding eco-friendly and economical deliverables to tackle this problem is a priority. In addition to physicochemical methods, exogenous application of phytohormones, i.e., auxins, cytokinins, and gibberellins, can positively influence the regulation of the ascorbate–glutathione cycle, transpiration rate, cell division, and the activities of nitrogen metabolism and assimilation, which improve plant growth activity. Brassinosteroids, ethylene and salicylic acid have been reported to enhance the level of the anti-oxidant system, decrease levels of ROS, lipid peroxidation and improve photosynthesis in plants, when applied exogenously under a HM effect. There is a crosstalk between phytohormones which is activated upon exogenous application. Research suggests that plants are primed by phytohormones for stress tolerance. Chemical priming has provided good results in plant physiology and stress adaptation, and phytohormone priming is underway. We have reviewed promising phytohormones, which can potentially confer enhanced tolerance when used exogenously. Exogenous application of phytohormones may increase plant performance under HM stress and can be used for agro-ecological benefits under environmental conditions with high HMs level.

     

Clinical Significance of Circulating Serum Levels of sCD95 and TNF-α in Cytoprotection of Cervical Cancer

Background:This study correlates the serum levels of sCD95 & TNF-α with a simple cell-based assay to evaluate the capacity of the serum sample to induce apoptosis in Jurkat cells. Interlinking of these parameters can be explored to design a minimum invasive diagnostic strategy for cervical cancer (CC).Methods:Sera samples were assessed to induce apoptosis in Jurkat cells through FACS. Serum levels of sCD95 and TNF-α were measured by ELISA. JNK phosphorylation was evaluated in sera incubated Jurkat cells. Data was scrutinized through statistical analysis.Results:Significantly higher serum levels of sCD95 and lower TNF-α levels were observed in CC patients; their sera samples inhibited induction of apoptosis in Jurkat cells through reduced JNK phosphorylation. Statistical analysis linked these three parameters for the early screening of CC.Conclusion:Distinct sera levels of sCD95 & TNF-α in CC patients showed an anti-apoptotic effect, which can be considered for early detection of CC.Key Words: Apoptosis, sCD95, Jurkat Cells, Tumor Necrosis Factor-alpha, Uterine Cervical Neoplasms     

The Slowing Rate of CpG Depletion in SARS-CoV-2 Genomes Is Consistent with Adaptations to the Human Host

Depletion of CpG dinucleotides in severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) genomes has been linked to virus evolution, host-switching, virus replication, and innate immune responses. Temporal variations, if any, in the rate of CpG depletion during virus evolution in the host remain poorly understood. Here, we analyzed the CpG content of over 1.4 million full-length SARS-CoV-2 genomes representing over 170 million documented infections during the first 17 months of the pandemic. Our findings suggest that the extent of CpG depletion in SARS-CoV-2 genomes is modest. Interestingly, the rate of CpG depletion is highest during early evolution in humans and it gradually tapers off, almost reaching an equilibrium; this is consistent with adaptations to the human host. Furthermore, within the coding regions, CpG depletion occurs predominantly at codon positions 2-3 and 3-1. Loss of ZAP (Zinc-finger antiviral protein)-binding motifs in SARS-CoV-2 genomes is primarily driven by the loss of the terminal CpG within the motifs. Nonetheless, majority of the CpG depletion in SARS-CoV-2 genomes occurs outside ZAP-binding motifs. SARS-CoV-2 genomes selectively lose CpGs-motifs from a U-rich context; this may help avoid immune recognition by TLR7. SARS-CoV-2 alpha-, beta-, and delta-variants of concern have reduced CpG content compared to sequences from the beginning of the pandemic. In sum, we provide evidence that the rate of CpG depletion in virus genomes is not uniform and it greatly varies over time and during adaptations to the host. This work highlights how temporal variations in selection pressures during virus adaption may impact the rate and the extent of CpG depletion in virus genomes.     

Genetic improvement of peanut (Arachis hypogea L.) genotypes by developing short duration hybrids

Peanut, the only cash crop of rainfed areas of Pakistan, is facing immense challenges due to global warming. Climatic factors particularly the temperature fluctuations and rain pattern shift significantly impact the production and yield of peanut and unavailability of resilient varieties exacerbate this impact. To deal with the cropping pattern change and yield losses, due to climate vagaries, a study was conducted to develop early maturing hybrids using line into tester mating design. The F₁ hybrids from the parental lines were produced in the year 2018 using Line × Tester mating design and then grown in the field in the year 2019 for further evaluation. The hybrids were evaluated based on the early maturity and yield-related attributes in comparison with the parental lines. Based on the general combining ability estimate, line V-3 (Golden), was found as best parent with highly significant values for plant height, days to peg formation, days to maturity, number of pegs per plant, number of pods per plants, number of seeds per plant, 100 pod weight 100 seed weight. Similarly, tester V-7 (PI 635006 01 SD) showed highly significant results of GCA for days to germination, day to 50% flowering, plant height, days to peg formation, days to maturity, number of pegs per plant, number of pods per plants, number of seeds per plant, 100 kernel weight, shelling percentage. All the combinations were evaluated for specific combining ability and significant results were observed for V-3 × V-4 (Golden × PI 619175 01 SD) and V-1 × V-6 (BARI-2000 × PI 564846 01 SD) by developing or maturity and yield-related attributes. The hybrid combinations V-3 × V-5 (Golden × PI 635006 01 SD) followed by V-3 × V-6 showed highly significant results for mid parent heterosis and better parent heterosis for days to 50% flowering, plant height, days to peg formation, number of pegs, days to maturity, number of mature seeds per plant, shelling ratio, 100 pod weight and 100 kernel weight. These parents and hybrid combinations with early maturity genes and high yield attributes can further be used for the development of short duration variety.     

A convenient and biogenetic type synthesis of few naturally occurring chromeno dihydrochalcones and their in vitro antileishmanial activity

2',2'-Dimethyl chromeno dihydrochalcones are very rare in nature as plant secondary metabolites. Recently we have reported three such compounds from the plant Crotalaria ramosissima. Chromeno dihydrochalcones contain a 2',2'-dimethyl benzopyran system, which are frequently encountered in many natural products and exhibit a variety of biological activities. We here report the strategy to conveniently synthesize naturally occurring chromeno dihydrochalcones by biogenetic type pyridine or Amberlyst-15 catalyzed chromenylation of dihydrochalcones and in vitro antileishmanial activity of chromeno dihydrochalcones and their intermediates.     

Use of polyethyleneimine polymer in cell culture as attachment factor and lipofection enhancer

Background  

Several cell lines and primary cultures benefit from the use of positively charged extracellular matrix proteins or polymers that enhance their ability to attach to culture plates. Polyethyleneimine is a positively charged polymer that has gained recent attention as a transfection reagent. A less known use of this cationic polymer as an attachment factor was explored with several cell lines.