Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Compositional dynamics and codon usage pattern of BRCA1 gene across nine mammalian species

The BRCA1 gene is located on the human chromosome 17q21.31 and plays important role in biological processes. The aminoacyl-tRNA synthetases (AARS) are a family of heterogenous enzymes responsible protein synthesis and whose secondary functions include a role in autoimmune myositis. Our findings reveal that the compositional constraint and the preference of more A/T –ending codons determine the codon usage patterns in BRCA1 gene while more G/C-ending codons influence the codon usage pattern of AARS gene among mammals. The codon usage bias in BRCA1 and AARS genes is low. The codon CGC encoding arginine amino acid and the codon TTA encoding leucine were uniformly distributed in BRCA1 and AARS genes, respectively in mammals including human. Natural selection might have played a major role while mutation pressure might have played a minor role in shaping the codon usage pattern of BRCA1 and AARS genes.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Synthesis, absolute stereochemistry and molecular design of the new antifungal and antibacterial antibiotic produced by Streptomyces sp.201

The absolute stereochemistry of the new antifungal and antibacterial antibiotic produced by Streptomyces sp.201 has been established by achieving the total synthesis of the product. A series of analogues have also been synthesized by changing the side chain and their bioactivity assessed against different microbial strains. Among them, 1e (R = C8H17) was found to be the most potent with MIC of 8 microg/mL against Mycobacterium tuberculosis, 12 microg/mL against Escherichia coli and 16 microg/mL against Bacillus subtilis 6 microg/mL against Proteus vulgaris. This was followed by 1b (R = C5H11) with MIC of 10-20 microg/mL range and 1d (R = C7H15) with MIC of 14-24 g/mL, whereas 1a (R = C4H9) and 1f (R = C18H35) were found to be completely inactive. Besides, 1c (R = C6H13) showed certain extent of antibacterial activity in the range of 24-50 microg/mL. Mycobacterium tuberculosis was very sensitive to 1e (R = C8H17) with MIC of 8 microg/mL. Antifungal activity of analogues 1d (R = C7H15) and 1e, (R = C8H17) against Fusarium oxysporum and Rhizoctonia solani were found promising with MFCs in the 15-18 microg/mL range.     

A convenient and biogenetic type synthesis of few naturally occurring chromeno dihydrochalcones and their in vitro antileishmanial activity

2',2'-Dimethyl chromeno dihydrochalcones are very rare in nature as plant secondary metabolites. Recently we have reported three such compounds from the plant Crotalaria ramosissima. Chromeno dihydrochalcones contain a 2',2'-dimethyl benzopyran system, which are frequently encountered in many natural products and exhibit a variety of biological activities. We here report the strategy to conveniently synthesize naturally occurring chromeno dihydrochalcones by biogenetic type pyridine or Amberlyst-15 catalyzed chromenylation of dihydrochalcones and in vitro antileishmanial activity of chromeno dihydrochalcones and their intermediates.     

GeneOrder3.0: Software for comparing the order of genes in pairs of small bacterial genomes

Background  

An increasing number of whole viral and bacterial genomes are being sequenced and deposited in public databases. In parallel to the mounting interest in whole genomes, the number of whole genome analyses software tools is also increasing. GeneOrder was originally developed to provide an analysis of genes between two genomes, allowing visualization of gene order and synteny comparisons of any small genomes. It was originally developed for comparing virus, mitochondrion and chloroplast genomes. This is now extended to small bacterial genomes of sizes less than 2 Mb.     

Use of polyethyleneimine polymer in cell culture as attachment factor and lipofection enhancer

Background  

Several cell lines and primary cultures benefit from the use of positively charged extracellular matrix proteins or polymers that enhance their ability to attach to culture plates. Polyethyleneimine is a positively charged polymer that has gained recent attention as a transfection reagent. A less known use of this cationic polymer as an attachment factor was explored with several cell lines.     

Antineoplastic and antibacterial activity of some mononuclear Ru(II) complexes

These ligands (L) show a bidentate behavior, forming octahedral ruthenium complexes. The title complexes were subjected to in-vivo anticancer activity tests against a transplantable murine tumor cell line, Ehrlich's Ascitic Carcinoma (EAC) and in-vitro antibacterial activity against several Gram positive and Gram negative bacterial strains. [Ru(bpy)2(ihqs)]Cl2 and [Ru(bpy)2 (hc)]Cl2 (where bpy = 2,2'-bipyridine, ihqs = 7-iodo-8hydroxy quinoline-5-sulphonic acid and hc = 3-hydroxy coumarin) showed promising antitumor activity. Treatment with these complexes prolonged the life span of EAC bearing mice as well as decreased their tumor volume and viable ascitic cell count. All the tested complexes exhibited mild to moderate antibacterial activity.