Mechanism of Acetic Acid Gustatory Repulsion in Drosophila

1. Download high-res image (206KB)
2. Download full-size image

     

Visceral leishmaniasis: what are the needs for diagnosis, treatment and control?

Visceral leishmaniasis (VL) is a systemic protozoan disease that is transmitted by phlebotomine sandflies. Poor and neglected populations in East Africa and the Indian sub-continent are particularly affected. Early and accurate diagnosis and treatment remain key components of VL control. In addition to improved diagnostic tests, accurate and simple tests are needed to identify treatment failures. Miltefosine, paromomycin and liposomal amphotericin B are gradually replacing pentavalent antimonials and conventional amphotericin B as the preferred treatments in some regions, but in other areas these drugs are still being evaluated in both mono- and combination therapies. New diagnostic tools and new treatment strategies will only have an impact if they are made widely available to patients.     

Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

A convenient and biogenetic type synthesis of few naturally occurring chromeno dihydrochalcones and their in vitro antileishmanial activity

2',2'-Dimethyl chromeno dihydrochalcones are very rare in nature as plant secondary metabolites. Recently we have reported three such compounds from the plant Crotalaria ramosissima. Chromeno dihydrochalcones contain a 2',2'-dimethyl benzopyran system, which are frequently encountered in many natural products and exhibit a variety of biological activities. We here report the strategy to conveniently synthesize naturally occurring chromeno dihydrochalcones by biogenetic type pyridine or Amberlyst-15 catalyzed chromenylation of dihydrochalcones and in vitro antileishmanial activity of chromeno dihydrochalcones and their intermediates.     

Use of polyethyleneimine polymer in cell culture as attachment factor and lipofection enhancer

Background  

Several cell lines and primary cultures benefit from the use of positively charged extracellular matrix proteins or polymers that enhance their ability to attach to culture plates. Polyethyleneimine is a positively charged polymer that has gained recent attention as a transfection reagent. A less known use of this cationic polymer as an attachment factor was explored with several cell lines.