The mechanism of phosphatidylcholine‐induced interference of PAP (248‐286) aggregation

Seminal amyloids are well known for their role in enhancing HIV infection. Among all the amyloidogenic peptides identified in human semen, PAP_248‐286 was found to be the most active and was termed as semen‐derived enhancer of viral infection (SEVI). Although amyloidogenic nature of the peptide is mainly linked with enhancement of the viral infection, the most active physiological conformation of the aggregated peptide remains inconclusive. Lipids are known to modulate aggregation pathway of a variety of proteins and peptides and constitute one of the most abundant biomolecules in human semen. PAP_248‐286 significantly differs from the other known amyloidogenic peptides, including Aβ and IAPP, in terms of critical concentration, surface charge, fibril morphology, and structural transition during aggregation. Hence, in the present study, we aimed to assess the effect of a lipid, 1,2‐dioleoyl‐sn‐glycero‐3‐phosphocholine (DOPC), on PAP_248‐286 aggregation and the consequent conformational outcomes. Our initial observation suggested that the presence of the lipid considerably influenced the aggregation of PAP_248‐286. Further, ZDOCK and MD simulation studies of peptide multimerization have suggested that the hydrophobic residues at C‐terminus are crucial for PAP_248‐286 aggregation and are anticipated to be major DOPC‐interacting partners. Therefore, we further assessed the aggregation behaviour of C‐terminal (PAP_273‐286) fragment of PAP_248‐286 and observed that DOPC possesses the ability to interfere with the aggregation behaviour of both the peptides used in the current study. Mechanistically, we propose that the presence of DOPC causes considerable inhibition of the peptide aggregation by interfering with the peptide's disordered state to β‐sheet transition.     

Mechanism of Acetic Acid Gustatory Repulsion in Drosophila

1. Download high-res image (206KB)
2. Download full-size image

     

Visceral leishmaniasis: what are the needs for diagnosis, treatment and control?

Visceral leishmaniasis (VL) is a systemic protozoan disease that is transmitted by phlebotomine sandflies. Poor and neglected populations in East Africa and the Indian sub-continent are particularly affected. Early and accurate diagnosis and treatment remain key components of VL control. In addition to improved diagnostic tests, accurate and simple tests are needed to identify treatment failures. Miltefosine, paromomycin and liposomal amphotericin B are gradually replacing pentavalent antimonials and conventional amphotericin B as the preferred treatments in some regions, but in other areas these drugs are still being evaluated in both mono- and combination therapies. New diagnostic tools and new treatment strategies will only have an impact if they are made widely available to patients.     

Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Genetic improvement of peanut (Arachis hypogea L.) genotypes by developing short duration hybrids

Peanut, the only cash crop of rainfed areas of Pakistan, is facing immense challenges due to global warming. Climatic factors particularly the temperature fluctuations and rain pattern shift significantly impact the production and yield of peanut and unavailability of resilient varieties exacerbate this impact. To deal with the cropping pattern change and yield losses, due to climate vagaries, a study was conducted to develop early maturing hybrids using line into tester mating design. The F₁ hybrids from the parental lines were produced in the year 2018 using Line × Tester mating design and then grown in the field in the year 2019 for further evaluation. The hybrids were evaluated based on the early maturity and yield-related attributes in comparison with the parental lines. Based on the general combining ability estimate, line V-3 (Golden), was found as best parent with highly significant values for plant height, days to peg formation, days to maturity, number of pegs per plant, number of pods per plants, number of seeds per plant, 100 pod weight 100 seed weight. Similarly, tester V-7 (PI 635006 01 SD) showed highly significant results of GCA for days to germination, day to 50% flowering, plant height, days to peg formation, days to maturity, number of pegs per plant, number of pods per plants, number of seeds per plant, 100 kernel weight, shelling percentage. All the combinations were evaluated for specific combining ability and significant results were observed for V-3 × V-4 (Golden × PI 619175 01 SD) and V-1 × V-6 (BARI-2000 × PI 564846 01 SD) by developing or maturity and yield-related attributes. The hybrid combinations V-3 × V-5 (Golden × PI 635006 01 SD) followed by V-3 × V-6 showed highly significant results for mid parent heterosis and better parent heterosis for days to 50% flowering, plant height, days to peg formation, number of pegs, days to maturity, number of mature seeds per plant, shelling ratio, 100 pod weight and 100 kernel weight. These parents and hybrid combinations with early maturity genes and high yield attributes can further be used for the development of short duration variety.     

A convenient and biogenetic type synthesis of few naturally occurring chromeno dihydrochalcones and their in vitro antileishmanial activity

2',2'-Dimethyl chromeno dihydrochalcones are very rare in nature as plant secondary metabolites. Recently we have reported three such compounds from the plant Crotalaria ramosissima. Chromeno dihydrochalcones contain a 2',2'-dimethyl benzopyran system, which are frequently encountered in many natural products and exhibit a variety of biological activities. We here report the strategy to conveniently synthesize naturally occurring chromeno dihydrochalcones by biogenetic type pyridine or Amberlyst-15 catalyzed chromenylation of dihydrochalcones and in vitro antileishmanial activity of chromeno dihydrochalcones and their intermediates.