Ubiquitin-Like Protein from Human Placental Extract Exhibits Collagenase Activity

An aqueous extract of human placenta exhibits strong gelatinase/collagenase activity in zymography. 2-D gel electrophoresis of the extract with gelatin zymography in the second dimension displayed a single spot, identified as ubiquitin-like component upon MALDI/TOF MS/MS analysis. Immunoblot indicated presence of ubiquitin and absence of collagenase in the extract. Collagenase activity of the ubiquitin-like component was confirmed from the change in solubility of collagen in aqueous buffer, degradation of collagen by size-exclusion HPLC and atomic force microscopy. Quantification with DQ-gelatin showed that the extract contains 0.04 U/ml of collagenase activity that was inhibited up to 95% by ubiquitin antibody. Ubiquitin from bovine erythrocytes demonstrated mild collagenase activity. Bioinformatics studies suggest that placental ubiquitin and collagenase follow structurally divergent evolution. This thermostable intrinsic collagenase activity of placental extract might have wide physiological relevance in degrading and remodeling collagen as it is used as a drug for wound healing and pelvic inflammatory diseases.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Purification of clinical-grade disulfide stabilized antibody fragment variable—Pseudomonas exotoxin conjugate (dsFv-PE38) expressed in Escherichia coli

Immunotoxins are rationally designed cancer targeting and killing agents. Disulfide stabilized antibody Fv portion—toxin conjugates (dsFv-toxin) are third generation immunotoxins containing only the antibody fragment variable portions and a toxin fused to the V_H or V_L. Pseudomonas exotoxin fragment (PE-38) is a commonly used toxin in immunotoxin clinical trials. dsFv-toxin purification was previously published, but the recovery was not satisfactory. This report describes the development of a cGMP production process of the dsFv-toxin that incorporated a novel purification method. The method has been successfully applied to the clinical manufacturing of two dsFv-PE38 immunotoxins, MR1-1 targeting EGFRvIII and HA22 targeting CD22. The two subunits, V_L and V_H PE-38 were expressed separately in Escherichia coli using recombinant technology. Following cell lysis, inclusion bodies were isolated from the biomass harvested from fermentation in animal source component-free media. The dsFv-toxin was formed after denaturation and refolding, and subsequently purified to homogeneity through ammonium sulfate precipitation, hydrophobic interaction and ion-exchange chromatography steps. It was shown, in a direct comparison experiment using MR1-1 as model protein, that the recovery from the new purification method was improved three times over that from previously published method. The improved recovery was also demonstrated during the clinical production of two dsFv-PE38 immunotoxins—MR1-1 and HA22.     

Change of antioxidant enzymes activity of hazel (Corylus avellana L.) cells by AgNPs

Elicitation effect of silver nano particles (AgNPs) and triggering of defence system by production of hydrogen peroxide (H₂O₂) as a signaling molecule in the regulation of the activity of stress-related enzymes and production of Taxol was evaluated in suspension- cultured hazel cells (Corylus avellana L.). The cells were treated with different concentrations of AgNPs (0, 2.5, 5, and 10 ppm), in their logarithmic growth phase (d7) and were harvested after 1 week. Treatment of hazel cells with AgNPs decreased the viability of the cells. Also the results showed that while the activity of certain radical scavenging enzymes in particular of catalase and peroxidase increased by 2.5 and 5 ppm AgNPs, the activity of superoxide dismutase decreased in these treatments. The highest activity of ascorbate peroxidase was observed in 10 ppm AgNPs treatments. This treatment also showed the highest contents of H₂O₂ and phenolic compounds, as well as the highest activity of phenylalanine ammonialyase. According to the results, 5 ppm AgNPs was the best concentration for elicitation of hazel cells to produce efficient amounts of H₂O₂ in order for stimulation of antioxidant defence system, production of Taxol at the highest capacity of the cells, meanwhile reserving their viability.     

Effects of Probiotic Yogurt on Serum Omentin-1, Adropin,and Nesfatin-1 Concentrations in Overweight and Obese Participants Under Low-Calorie Diet

Probiotics and Antimicrobial Proteins - Data on the effects of probiotics on adipokines such as omentin-1, nesfatin-1, and adropin are limited. The aim of this study was to evaluate the effects of...