Studies on metabolic role of 5′-methylthioadenosine in Ochromonas malhamensis and other microorganisms

Several compounds containing a thiomethyl group were found to replace vitamin B₁₂ in a protozoan, Ochromonas malhamensis. The order of the effectiveness was as follows: 5-methylthioadenosine > S-adenosylmethionine > 5-methylthioribose > L-methionine. A similar order was obtained with respect to the permeability of these compounds into the protozoan cells, except for S-adenosylmethionine. 5-Methylthioadenosine and 5-methylthioribose as well as l-methionine markedly increased the intracellular content of l-methionine. The level of S-adenosylmethionine was also increased by them, but to a lesser degree. The thiomethyl group of the compounds was established to be incorporated into S-adenosylmethionine. The metabolic fate of the thiomethyl group of 5-methylthioadenosine cannot be distinguished from that of l-methionine. A high activity of 5-methylthioadenosine nucleosidase was detected in the cell-free extracts of the protozoan. These results strongly suggest that 5-methylthioadenosine would be metabolized to l-methionine via 5-methylthioribose and then the l-methionine would be converted to S-adenosylmethionine. Like l-methionine and vitamin B₁₂, 5-methylthioadenosine and 5-methylthioribose may play an important role in maintenance of the C-1 pool in Ochromonas malhamensis.Neither 5-methylthioadenosine nor 5-methylthioribose replaced vitamin B₁₂ in some vitamin B₁₂-requiring bacteria. This result is consistent with the fact that neither compounds was significantly taken up by these bacteria.Abbreviations MTA 5-methylthioadenosine - AdoMet S-adenosylmethionine - MTR 5-methylthioribose - TCA trichloroacetic acid Paper II in the series. The first paper of the series has been published (Sugimoto and Fukui, 1974)     

Immunogenicity of lysozyme derivatives lipid-conjugated to various degrees in mice treated with and without cyclophosphamide: dissociation of delayed-type hypersensitivity and helper function.

Lysozyme and a series of its lipid-conjugated derivatives without adjuvant were examined in mice for their abilities to induce delayed-type hypersensitivity (DTH), helper T-cell activity, and antibody formation. In addition, the effect of cyclophosphamide (CY) on the immune responses was assessed in mice immunized with these lysozyme derivatives. Precipitated lysozyme without lipid conjugation was a good inducer of both antibody and DTH responses. Lipid conjugation to lysozyme to intermediate degrees readily caused the failure only in inducing the antibody response. As lysozyme was lipid-conjugated more heavily, DTH response was also reduced and finally abolished. In contrast, the helper activity was little affected by any degree of lipid conjugation. These results indicate that the helper T-cell activity was dissociated from the both DTH response and the antibody production. CY pretreatment extensively enhanced DTH response induced by such lipid-conjugated derivatives that failed to induce antibody response. Furthermore, CY pretreatment in doses in a wide range enhanced not only DTH response but also antibody formation. It is, therefore, concluded that the enhancement of DTH response by CY does not necessarily entail suppression of antibody formation.     

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').     

Lagenidium myophilum infection in the coonstripe shrimp,Pandalus hypsinotus

A fungal infection occurred in juvenile coonstripe shrimps,Pandalus hypsinotus, cultured at Hokkaido Institute of Mariculture, Hokkaido, Japan. The fungus was identified asLagenidium myophilum, the same fungus that had previously been isolated from the abdominal muscle of adult northern shrimps,Pandalus borealis, and larvae of the coonstripe shrimp. Histopathologically, numerous nonseptate hyphae were observed in the lesions, and melanized hemocytes were present within the blackened areas. The optimum temperature for growth of the present strain was 25–30°C, and the optimum NaCl concentration for growth was 0.5–1.0%. Its biological characteristics were compared with those ofLagenidium myophilum isolated from diseased larval coonstripe shrimp and adult northern shrimp. The fungus was pathogenic toward shrimps of the genusPandalus, which live in deep sea areas. The fungus could infect shrimps at various stages, from larva to adult.     

Magnesium ion: a possible physiological regulator of aldosterone production

We examined the direct effect of magnesium ion on aldosterone production by adrenal cells using collagenase-dispersed zona-glomerulosa cells in rats. The effects of magnesium on aldosterone production stimulated by angiotensin II or ACTH were also investigated. Both magnesium sulphate (MgSO4) and magnesium chloride (MgCl2) (0 to 2 mM) decreased aldosterone production in a dose-dependent manner. In comparison with magnesium-free medium, 2 mM MgSO4 inhibited aldosterone production by 73% and MgCl2 by 65%. In addition, MgSO4 showed an inhibitory effect on aldosterone production stimulated by angiotensin II (10pM to 10nM), whereas it had no significant effect on aldosterone production due to ACTH stimulation (10pM to 10nM). These data suggest that magnesium has an inhibitory action on aldosterone production in vitro and may be a physiological regulator of aldosterone production.     

The Relationship between Media Consumption and Health-Related Anxieties after the Fukushima Daiichi Nuclear Disaster

Background

The Fukushima Daiichi nuclear disaster caused a global panic by a release of harmful radionuclides. In a disaster setting, misusage of contemporary media sources available today can lead to disseminated incorrect information and panic. The study aims to build a scale which examines associations between media and individual anxieties, and to propose effective media usages for future disaster management.

Methods

The University of Tokyo collaborated with the Fukushima local government to conduct a radiation-health-seminar for a total of 1560 residents, at 12 different locations in Fukushima. A 13 item questionnaire collected once before and after a radiation-seminar was used on factor analysis to develop sub-scales for multiple regression models, to determine relationships between the sub-scales and media type consumed. A paired t–test was used to examine any changes in sub-scale of pre- and post-seminar scores.

Results

Three sub-scales were revealed and were associated with different media types: was with rumors, while concern for the future was positively associated with regional-newspapers and negatively with national-newspapers. Anxiety about social-disruption was associated with radio. The seminar had a significant effect on anxiety reduction for all the three sub-scales.

Conclusion

Different media types were associated with various heightened concerns, and that a radiation seminar was helpful to reduce anxieties in the post-disaster setting. By tailoring post-disaster messages via specific media types, i.e., radio, it may be possible to effectively convey important information, as well as to calm fears about particular elements of post-disaster recovery and to combat rumors.