Varicella-zoster virus (VZV) open reading frame 61 protein transactivates VZV gene promoters and enhances the infectivity of VZV DNA.

The varicella-zoster virus (VZV) open reading frame 61 (ORF61) protein is the homolog of herpes simplex virus type 1 (HSV-1) ICP0. Both genes are located in similar parts of the genome, their predicted products share a cysteine-rich motif, and cell lines expressing VZV ORF61 are able to complement an HSV-1 ICP0 deletion mutant (H. Moriuchi, M. Moriuchi, H. A. Smith, S. E. Straus, and J. I. Cohen, J. Virol. 66:7303-7308, 1992). In transient expression assays, HSV-1 ICP0 is a transactivator alone and transactivates in synergy with another viral transactivator, ICP4. However, VZV ORF61 represses the activation by VZV-encoded proteins ORF62 (the homolog of ICP4) and ORF4. To further characterize the function of VZV ORF61 and its role(s) in regulation of viral gene expression, we performed transient expression assays using target promoters from VZV, HSV-1, and unrelated viruses. In the absence of other viral activators, VZV ORF61 transactivated most promoters tested. In addition, a cell line stably expressing VZV ORF61 complemented the HSV-1 mutant in 1814, which lacks the transactivating function of VP16. The cell line expressing VZV ORF61 enhanced the infectivity of HSV-1 virion DNA. Moreover, transient expression of VZV ORF61 also enhanced the infectivity of VZV DNA. These results indicate that VZV ORF61 can stimulate expression of HSV-1 and VZV genes at an early stage in the viral replicative cycle and that ORF61 has an important role in VZV gene regulation.     

Structural differences of heparan sulfates according to the tissue and species of origin

Some structural features of thirteen heparan sulfates isolated from different mammalian tissues and species are reported. Two N-acetylated disaccharides, one of then O-sulfated and two N-sulfated disaccharides, one of then 6-sulfated are formed from these compounds by the combined action of heparitinases I and II from Flavobacterium heparinum. The relative proportions of the four disaccharide units vary quite significantly among the thirteen heparan sulfates indicating that the structure of these polymers are tissue and species specific. Based on the frequency of appearance of each one of the disaccharides it was calculated that 10(36) types of heparan sulfates might theoretically be found. The possible role of these polyanions in cell-cell recognition is discussed in view of the present findings.     

Extracellular products of type IIIStreptococcus agalactiae and their relationship to virulence

Various human isolates of type III group B streptococci (GBS) orStreptococcus agalactiae could be divided into two distinct groups (high and low producers) on the basis of their in vitro production of extracellular type-specific antigen (ETSA). The high ETSA producers were shown to be significantly more virulent in mice than were the low producers. In an effort to examine the possibility that purified extracellular products (ETSA, neuraminidase, or protease_ had a significant effect on GBS virulence in the mouse model, mice received either 1.0 ml of organisms intraperitoneally (IP) or 1.0 ml of organisms IP plus 0.1 ml IP of the appropriate purified extracellular products. Only purified ETSA demonstrated a substantial decrease (1.0 log₁₀) in the 50% lethal dose (LD₅₀) values and only for a high ETSA producing strain. Serum from mice infected with a high ETSA producer contained approximately 12.5 μg/ml of the ETSA, whereas serum from mice infected with a low ETSA producer contained no detectable ETSA. These data imply that the two different types of organisms (high and low ETSA producers) have somewhat different mechanisms of pathogenicity in the mouse model.     

Hitchhiking and linkage disequilibrium between hemoglobin S and nearby restriction sites

The association of the hemoglobin S mutation with an unusual 13 kb Hpa I restriction fragment has been reexamined using new data and a stochastic model for linkage disequilibrium. In agreement with earlier analyses with deterministic models, the present-day association of the beta S allele with the 13 kb fragment is lower than would be expected if all beta S alleles carried by American blacks were derived from a unique mutation that occurred in the ancestral Bantu population. However, from the stochastic model, if the effective population size was small for an appreciable period during the time that selection has been operating on HbS, then the confidence limits on the allelic association are very large and a unique West African beta S mutation cannot be ruled out from the two locus data alone.     

Degradation of vasoactive intestinal polypeptide by tissue homogenates

Extracts of liver, kidney and brain contain an enzyme that is highly specific for degradation of vasoactive intestinal polypeptide (VIP). The Michaelis constants (K_m's) appear to be nearly identical in all three tissues, averaging about 10^?5 mol/liter. The V_max for kidney and liver are about the same but that for cerebral cortex is about two-fold lower. Since the relative V_max in the three organs differ for insulin and VIP, it is concluded that it is unlikely that the same enzyme is responsible for the degradation of both peptides.     

Purification and partial characterization of neuraminidase from type III group B streptococci

Extracellular neuraminidase from a type III fresh clinical isolate of a group B streptococcus was purified by a combination of salt fractionation, affinity chromatography of Affi-Gel blue, ion-exchange chromatography on diethylaminoethylcellulose, and gel filtration on Sephacryl S-200. These procedures yielded enzyme which was purified approximately 1,000-fold compared with the enzyme found in the original supernatant fluid. This type III streptococcal neuraminidase had a molecular weight of approximately 125,000 as estimated by filtration on Sephacryl S-200 and approximately 106,000 when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. In contrast to the majority of other bacterial neuraminidases, the type III group B streptococcal enzyme had no effect on colominic acid or N-acetylneuramin-lactose; however, it was quite active on bovine submaxillary mucin.     

Varicella-zoster virus open reading frame 61 protein is functionally homologous to herpes simplex virus type 1 ICP0.

The varicella-zoster virus (VZV) open reading frame 61 (ORF61) protein is thought to be the homolog of herpes simplex virus type 1 (HSV-1) ICP0, based on gene location and limited amino acid homology. However, HSV-1 ICP0 trans activates HSV-1 genes, while VZV ORF61 protein trans represses the function of VZV trans activators on VZV promoters in transient expression assays. To investigate the functional relatedness of HSV-1 ICP0 and VZV ORF61 protein, we established Vero and MeWo cell lines which stably express VZV ORF61 under the control of a metallothionein promoter and performed complementation studies with an HSV-1 ICP0 deletion mutant (7134). Mutant 7134 is impaired for plaque formation and replication at a low multiplicity of infection in cell culture, but these defects were complemented by up to 200-fold in Vero cell lines expressing VZV ORF61. Likewise, the efficiency of plaque formation was improved by up to 100-fold in MeWo cell lines expressing VZV ORF61. A cell line expressing another VZV immediate-early gene product (ORF62) was unable to complement mutant 7134. HSV-1 mutants which are deleted for other HSV-1 immediate-early gene products (ICP4, ICP27) were unable to grow in VZV ORF61-expressing cell lines. These results indicate that, despite marked differences in their sequences and in effects on their cognate promoters in transient expression assays, VZV ORF61 protein is the functional homolog of HSV-1 ICP0.     

D-alanine oxidase from Escherichia coli: participation in the oxidation of L-alanine

Cell wall-membrane preparations of Escherichia coli, prepared by the ethylenediaminetetraacetic acid-lysozyme method, contain enzymes which catalyze the oxidation of d-alanine and, to a lesser extent, l-alanine into pyruvate and ammonia without the formation of hydrogen peroxide. The kinetic parameters were (i) pH optima of 8.3 to 8.4 for l- and d-alanine and (ii) a K(m) value of 6.6 +/- 0.2 mM for d-alanine. Several coenzymes were without effect when added to the reaction mixture. The participation of d-alanine oxidase in the oxidation of l-alanine was demonstrated. The evidence is based on (i) results of cellular fractionation; (ii) labeling experiments; (iii) inhibition studies with aminooxyacetate and cycloserine; (iv) denaturation experiments; and (v) demonstration of the presence of an active racemase.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.