Theoretical studies on animal orientation. I. Methodological appraisal of classifications

Research on animal orientation shows a persistent lack of integration. Theories entertained in different “schools” are couched in incommensurable terms. The underlying definitions mostly do not satisfy elementary canons of methodology, and this results in a confusion of empirical and conceptual problems. Application of basic methodology shows that current classifications of orientation patterns are logically incomplete.Moreover, allegedly distinct kinds of orientation wrongly show logical dependencies resulting from poor definitions. Reference to physiological mechanisms, beyond stimuli and responses, must be omitted from definitions for orientation patterns. Likewise, orientation must not be made functional (adaptive) by definition. Vagueness is to some extent unavoidable in general theories.     

The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

The isolated perfused rabbit ovary — A model for studies of ovarian function

Summary In the present investigation the ultrastructure of isolated rabbit ovaries, perfused with different media for various time periods, was studied. The steroid hormone production by the perfused ovary was also determined. Perfusion with Medium 199 results in prominent interstitial ovarian oedema which increases with perfusion time. Even after the addition of 6–10 % Dextran T40, oedema appears in the interstitial tissue of the ovary. Perfusion solutions with osmotically active colloid particles of large molecular size (Dextran T70; average molecular weight 70,000 and bovine serum albumin), cause less distortion in the ovarian structure, and ultrastructurally the ovarian tissues appear essentially the same as in the control ovaries.The results indicate that the perfused rabbit ovary, under strictly controlled conditions, can be used as an experimental model for studies of various aspects of ovarian function, including follicular rupture.     

Studies on dissimilatory sulfate-reducing bacteria that decompose fatty acids

Three strains (2ac9, 3ac10 and 4ac11) of oval to rodshaped, Gram negative, nonsporing sulfate-reducing bacteria were isolated from brackish water and marine mud samples with acetate as sole electron donor. All three strains grew in simple defined media supplemented with biotin and 4-aminobenzoic acid as growth factors. Acetate was the only electron donor utilized by strain 2ac9, while the other two strains used in addition ethanol and/or lactate. Sulfate served as electron acceptor and was reduced to H₂S. Complete oxidation of acetate to CO₂ was shown by stoichiometric measurements with strain 2ac9 in batch cultures using sulfate, sulfite or thiosulfate as electron acceptors. With sulfate an average growth yield of 4.8 g cell dry weight was obtained per mol of acetate oxidized; with sulfite or thiosulfate the growth yield on acetate was about twice as high. None of the strains contained desulfoviridin. In strain 2ac9 cytochromes of the b- and c-type were detected. Strain 2ac9 is described as type strain of the new species and genus, Desulfobacter postgatei.     

A new anaerobic,sporing, acetate-oxidizing,sulfate-reducing bacterium,Desulfotomaculum (emend.) acetoxidans

Archives of Microbiology - A new strictly anaerobic, polarly flagellated, sporing, acetate-oxidizing, sulfate-reducing bacterium was isolated from anaerobic fresh or sea water mud samples. The...     

The flagellar root apparatus,the microtubular system and associated organelles in the chrysophycean flagellate,Poterioochromonas malhamensis Peterfi (syn.Poteriochromonas stipitata Scherffel andOchromonas malhamensis pringsheim)

Summary The two flagella ofPoterioochromonas are inserted in an apical platform which is shaped by six long flagellar root fibres. The arrangement and structure of these root fibres are described in detail. One of these fibres is the single nucleating site for cytoplasmic interphase microtubules which extend peripherally down to the cytoplasmic tail. Another fibre proceeds toward the centre of the cell and passes the nucleus but is different in structure, position and function from the striated rhizoplast found in many chrysophycean flagellates which is observed but vestigial inPoterioochromonas.A specific kinetosomal mitochondrion has a threefold attachment to the flagellar root apparatus. The chloroplast is also bound to the root system. It has no stigma, but a special continuation of the periplastidial cisterna is developed instead. Another cisterna extends from the nuclear envelope-dictyosome interspace to the kinetosome of the long flagellum. The functional and taxonomic meanings of these structures and of their mutual arrangement are discussed. It is concluded that the present strain (no. 933-1 a of the Collection of Algal Cultures at the Institute of Plant Physiology, Göttingen) has to be excluded from the genusOchromonas.