l-NNA inhibits the histochemical NADPH-d reaction in rat spinal cord neurons

In nerve tissue the histochemical nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) reaction is considered a suitable marker for nitric oxide synthase (NOS) activity. We have previously shown that the NOS-specific inhibitorl-nitroarginine (l-NNA) can block NADPH-d staining in intermediolateral (IML) neurons of the rat spinal cord; such a reaction might serve as a control for the presence of a NOS-related catalytic activity, i.e.,l-NNA-dependent NO synthesis in these neurons. However,l-NNA inhibition of neuronal NADPH-d is inconsistent and is therefore disputed by others. This prompted us to reinvestigate the reaction conditions to provide a standardized protocol for inhibition experiments. In IML neurons of formaldehyde-fixed spinal cord tissue, inhibition of NADPH-d reaction was tested by preincubation of frozen sections with the flavin-binder diphenylene iodonium chloride (DPI, 10 M-1 mM) which blocked the NADPH-d reaction in a concentration-dependent way, suggesting an inverse relationship of inhibitor concentration and final reaction product generated. Preincubation with the NOS-specific inhibitorl-NNA in glycine-NaOH buffer (pH 8.5–9.5) but notl-nitroarginine methyl ester (l-NAME) revealed a concentration-dependent blocking effect on neuronal NADPH-d comparable to the effects seen with DPI, suggesting the existence of al-NNA sensitive NADPH-d activity. Blocking withl-NNA (100 M-10 mM) was prevented by excessl-arginine (10–100 mM), suggesting competitive binding sites. NADPH-d staining was not inhibited by 7-nitro indazole, another NOS inhibitor. Thus, in formaldehyde-fixed nervous tissue both DPI andl-NNA inhibit the NOS-associated catalytic NADPH-d activity, thereby preventing NADPH-dependent conversion of nitroblue tetrazolium to formazan.Presented in the Workshop Detection of NO-synthases at the XXXVI Symposium of the Society for Histochemistry on Oxy Radicals, 20–23 September 1994, Heidelberg, Germany     

Synthesis and evaluation of novel daunomycin-phosphate-sulfate -β-glucuronide and -β-glucoside prodrugs for application in adept

The synthesis, antiproliferative effect and enzymatic hydrolysis of daunomycin-3′-N- and -4′-O-phosphate and -sulfate derivatives and of daunomycin-3′-N-CO-β-glucuronide and -β-glucoside, designed to be prodrugs in ADEPT are described. The phosphate derivatives were almost as toxic as the parent drug whereas the sulfates were not hydrolyzed by aryl sulfatases. Glucuronyl and glucosyl prodrugs were found to be useful for application in ADEPT.     

The human fibrin-stabilizing factors

Summary A review of the present knowledge of human fibrin-stabilizing factors (FSFs) is given. Thus far three human FSFs have been isolated and characterized, namely the FSFs from plasma, platelets and placentae.Placental and platelet FSF are identical; their molecules are composed of two identical polypeptide chains (subunits A) having a molecular weight of 80.000 daltons which are held together by non-covalent bonds. The subunit structure of these FSFs can be written A2.The molecules of plasma FSF (factor XIII) also contain 2 subunits A but in addition another component (subunit S, molecular weight 180.000 daltons) which are held together by non-covalent bonds, too. The subunit structure of plasma factor XIII can be written A₂S.The physical and immunochemical properties as well as the amino acid and carbohydrate composition of the FSFs, respectively of the subunits A and S are reported.The biological active part in the FSFs resides in subunit A. The biological role of subunit S is unknown. Protein S occurs in normal plasma in a free state, too; it combines with placental or platelet FSF to form a complex A₂S which is indistinguishable from plasma factor XIII. It has been suggested to designate protein S as FSF-binding globulin.The human FSFs are proenzymes which have to be activated by thrombin. The activation step is a limited proteolysis resulting in the release of a peptide (36 amino acid residues) from subunit A. The enzymes formed are transglutaminases; they crosslink the fibrin molecules by the formation of -glutamyl-s-lysine bonds, a process which is designated as fibrin-stabilization.The different methods which exist for assessment of the FSFs are reported. Deficiencies in FSFs which occur can be either hereditary or acquired. The possibilities of substituting FSFs in cases of deficiency and for accelerating wound healing after major surgeries are described.     

Cytochemical and electrophoretic studies of haemoglobin synthesis in the fat body of a midge, Chironomus thummi

The fat body of developing mid- and late fourth instar larvae of a midge, Chironomus thummi, has been investigated by means of the benzidine reaction for the localization of haemoglobin within cells. In the subepidermal fat body the reaction deposits of the haemoglobin pseudo-peroxidase activity appear predominantly in the intracisternal cavities of ER and the Golgi, and later, in the pharate pupal stage, in small dense granules (0.5–1 μm in. diameter).All the major protein bands of fat body extracts, which are resolved in electrophoresis, give the benzidine reaction and show incorporation of ¹⁴C-amino levulinic acids, in this case a specific marker for haemoglobin synthesis. In addition, labelled proteins show identical electrophoretic mobility as the haemoglobins of the haemolymph, suggesting that haemoglobins are synthesized in the fat body. Two types of fat body cells seem to differ with respect to their rôle in haemoglobin metabolism.     

Galactolipid synthesis in chromoplasts in vitro

Isolated chromoplasts from Narcissus pseudonarcissus flowers contain: a fatty acid synthesizing system; acyl-CoA synthetase (EC 6.2.1.3); glycero-phosphate acyltransferase (EC 2.3.1.15); acylglycero-phosphate acyltransferase; phosphatidate phosphatase (EC 3.1.3.4); diacylglycerol galactosyltransferase (EC 2.4.1.46); and diacylgalactosylglycerol galactosyltransferase, i.e. all enzymatic activities necessary for the synthesis of diacylgalactosylglycerol and diacylgalabiosylglycerol from acetate, HCO _- ³ , sn-glycerol 3-phosphate, and UDP-d-galactose. Diacylgalactosylglycerol and diacylgalabiosylglycerol, however, are synthesized from these precursors to only a very low extent in an in vitro system. This is attributed to a specificity of diacylglycerol galactosyltransferase for highly unsaturated diacylglycerols. Specificities of acyltransferase reactions were also found.     

The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.