Activation loop targeting strategy for design of receptor-interacting protein kinase 2 (RIPK2) inhibitors

Development of selective kinase inhibitors remains a challenge due to considerable amino acid sequence similarity among family members particularly in the ATP binding site. Targeting the activation loop might offer improved inhibitor selectivity since this region of kinases is less conserved. However, the strategy presents difficulties due to activation loop flexibility. Herein, we report the design of receptor-interacting protein kinase 2 (RIPK2) inhibitors based on pan-kinase inhibitor regorafenib that aim to engage basic activation loop residues Lys169 or Arg171. We report development of CSR35 that displayed >10-fold selective inhibition of RIPK2 versus VEGFR2, the target of regorafenib. A co-crystal structure of CSR35 with RIPK2 revealed a resolved activation loop with an ionic interaction between the carboxylic acid installed in the inhibitor and the side-chain of Lys169. Our data provides principle feasibility of developing activation loop targeting type II inhibitors as a complementary strategy for achieving improved selectivity.     

Glucuronides of monohydroxylated bile acids: specificity of microsomal glucuronyltransferase for the glucuronidation site, C-3 configuration, and side chain length

The ability of rat liver microsomes to catalyze UDP-glucuronic acid-dependent glucuronidation of monohydroxy-bile acids was examined. The following bile acids were used as substrates, each as the 3 alpha and 3 beta epimer: 3-hydroxy-5 beta-cholanoic acid (C24), 3-hydroxy-5 beta-norcholanoic acid (C23), 3-hydroxy-5 beta-bisnorcholanoic acid (C22), 3-hydroxy-5 beta-pregnan-21-oic acid (C21), and 3-hydroxy-5 beta-androstane-17 beta-carboxylic acid (C20). The corresponding glucuronides were chemically synthesized to serve as standards and were characterized by thin-layer and gas-liquid chromatography as well as by nuclear magnetic resonance. Enzymatic glucuronidation reactions were optimized with respect to pH for each product formed and the kinetic parameters for each reaction were measured. Analytical techniques necessary to separate products from unreacted substrates and to identify them included thin-layer chromatography, gas-liquid chromatography, and nuclear magnetic resonance. It was found that the 3 alpha epimers of the five bile acids listed above enzymatically formed 3-O-glucuronides, C24 being the best substrate, followed by C21 and C20; C22 and C23 gave rise to only small amounts of this product. The 3 beta epimers of all bile acids tested were poorer substrates, although by a factor that varied widely. In addition to the expected hydroxyl-linked glucuronide, three of the 3 alpha-bile acids (C23, C22, and C20) and at least one 3 beta-bile acid (C20), gave rise to a novel metabolite in which the 1-OH of glucuronic acid was esterified with the steroidal carboxyl group (carboxyl-linked glucuronide).     

Quantifying Missing Heritability at Known GWAS Loci

Recent work has shown that much of the missing heritability of complex traits can be resolved by estimates of heritability explained by all genotyped SNPs. However, it is currently unknown how much heritability is missing due to poor tagging or additional causal variants at known GWAS loci. Here, we use variance components to quantify the heritability explained by all SNPs at known GWAS loci in nine diseases from WTCCC1 and WTCCC2. After accounting for expectation, we observed all SNPs at known GWAS loci to explain more heritability than GWAS-associated SNPs on average (). For some diseases, this increase was individually significant: for Multiple Sclerosis (MS) () and for Crohn''s Disease (CD) (); all analyses of autoimmune diseases excluded the well-studied MHC region. Additionally, we found that GWAS loci from other related traits also explained significant heritability. The union of all autoimmune disease loci explained more MS heritability than known MS SNPs () and more CD heritability than known CD SNPs (), with an analogous increase for all autoimmune diseases analyzed. We also observed significant increases in an analysis of Rheumatoid Arthritis (RA) samples typed on ImmunoChip, with more heritability from all SNPs at GWAS loci () and more heritability from all autoimmune disease loci () compared to known RA SNPs (including those identified in this cohort). Our methods adjust for LD between SNPs, which can bias standard estimates of heritability from SNPs even if all causal variants are typed. By comparing adjusted estimates, we hypothesize that the genome-wide distribution of causal variants is enriched for low-frequency alleles, but that causal variants at known GWAS loci are skewed towards common alleles. These findings have important ramifications for fine-mapping study design and our understanding of complex disease architecture.     

Imputing Amino Acid Polymorphisms in Human Leukocyte Antigens

DNA sequence variation within human leukocyte antigen (HLA) genes mediate susceptibility to a wide range of human diseases. The complex genetic structure of the major histocompatibility complex (MHC) makes it difficult, however, to collect genotyping data in large cohorts. Long-range linkage disequilibrium between HLA loci and SNP markers across the major histocompatibility complex (MHC) region offers an alternative approach through imputation to interrogate HLA variation in existing GWAS data sets. Here we describe a computational strategy, SNP2HLA, to impute classical alleles and amino acid polymorphisms at class I (HLA-A, -B, -C) and class II (-DPA1, -DPB1, -DQA1, -DQB1, and -DRB1) loci. To characterize performance of SNP2HLA, we constructed two European ancestry reference panels, one based on data collected in HapMap-CEPH pedigrees (90 individuals) and another based on data collected by the Type 1 Diabetes Genetics Consortium (T1DGC, 5,225 individuals). We imputed HLA alleles in an independent data set from the British 1958 Birth Cohort (N = 918) with gold standard four-digit HLA types and SNPs genotyped using the Affymetrix GeneChip 500 K and Illumina Immunochip microarrays. We demonstrate that the sample size of the reference panel, rather than SNP density of the genotyping platform, is critical to achieve high imputation accuracy. Using the larger T1DGC reference panel, the average accuracy at four-digit resolution is 94.7% using the low-density Affymetrix GeneChip 500 K, and 96.7% using the high-density Illumina Immunochip. For amino acid polymorphisms within HLA genes, we achieve 98.6% and 99.3% accuracy using the Affymetrix GeneChip 500 K and Illumina Immunochip, respectively. Finally, we demonstrate how imputation and association testing at amino acid resolution can facilitate fine-mapping of primary MHC association signals, giving a specific example from type 1 diabetes.     

Distribution of RNA binding protein MOEP19 in the oocyte cortex and early embryo indicates pre-patterning related to blastomere polarity and trophectoderm specification

We report the cloning and characterization of MOEP19, a novel 19 kDa RNA binding protein that marks a defined cortical cytoplasmic domain in oocytes and provides evidence of mammalian oocyte polarity and a form of pre-patterning that persists in zygotes and early embryos through the morula stage. MOEP19 contains a eukaryotic type KH-domain, typical of the KH-domain type I superfamily of RNA binding proteins, and both recombinant and native MOEP19 bind polynucleotides. By immunofluorescence, MOEP19 protein was first detected in primary follicles throughout the ooplasm. As oocytes expanded in size during oogenesis, MOEP19 increased in concentration. MOEP19 localized in the ovulated egg and early zygote as a symmetrical spherical cortical domain underlying the oolemma, deep to the zone of cortical granules. MOEP19 remained restricted to a cortical cytoplasmic crescent in blastomeres of 2-, 4- and 8-cell embryos. The MOEP19 domain was absent in regions underlying cell contacts. In morulae, the MOEP19 domain was found at the apex of outer, polarized blastomeres but was undetectable in blastomeres of the inner cell mass. In early blastocysts, MOEP19 localized in both mural and polar trophectoderm and a subset of embryos showed inner cell mass localization. MOEP19 concentration dramatically declined in late blastocysts. When blastomeres of 4- to 8-cell stages were dissociated, the polarized MOEP19 domain assumed a symmetrically spherical localization, while overnight culture of dissociated blastomeres resulted in formation of re-aggregated embryos in which polarity of the MOEP19 domain was re-established at the blastomere apices. MOEP19 showed no evidence of translation in ovulated eggs, indicating that MOEP19 is a maternal effect gene. The persistence during early development of the MOEP19 cortical oocyte domain as a cortical crescent in blastomers suggests an intrinsic pre-patterning in the egg that is related to the apical-basolateral polarity of the embryo. Although the RNAs bound to MOEP19 are presently unknown, we predict that the MOEP19 domain directs RNAs essential for normal embryonic development to specific locations in the oocyte and early embryo.     

The in vitro antibiofilm activity of selected marine bacterial culture supernatants against Vibrio spp.

The aim of the work is to investigate the effect of marine bacterial culture supernatants on biofilm formation of Vibrio spp., a major menace in aquaculture industries. Vibrio spp. biofilm cause life-threatening infections in humans and animals. Forty-three marine bacterial culture supernatants were screened against the hydrophobicity index, initial attachment and biofilm formation in Vibrio spp. Twelve culture supernatants showed antibiofilm activity. The bacterial culture supernatants S8-07 (Bacillus pumilus) and S6-01 (B. indicus) inhibited the initial attachment, biofilm formation and dispersed the mature biofilm at 5% v/v concentration without inhibiting the growth. Analysis by light microscopy and confocal laser scanning microscopy showed that the architecture of the biofilm was destroyed by bacterial supernatants when compared to the control. The bacterial supernatants also reduce the surface hydrophobicity of Vibrio spp. which is one of the important requirements for biofilm formation. Further characterization of antibiofilm activity in S8-07 culture supernatant confirmed that it is an enzymatic activity and the size is more than 10 kDa and in S6-01, it is a heat-stable, non-protein compound. Furthermore, both the supernatants failed to show any biosurfactant activity. The culture supernatants of S8-07 and S6-01 with promising antibiofilm property have potential for application in medicine and marine aquaculture.     

Arginine methylation in subunits of mammalian pre-mRNA cleavage factor I

Mammalian cleavage factor I (CF I_m) is composed of two polypeptides of 25 kDa and either a 59 or 68 kDa subunit (CF I_m25, CF I_m59, CF I_m68). It is part of the cleavage and polyadenylation complex responsible for processing the 3′ ends of messenger RNA precursors. To investigate post-translational modifications in factors of the 3′ processing complex, we systematically searched for enzymes that modify arginines by the addition of methyl groups. Protein arginine methyltransferases (PRMTs) are such enzymes that transfer methyl groups from S-adenosyl methionine to arginine residues within polypeptide chains resulting in mono- or dimethylated arginines. We found that CF I_m68 and the nuclear poly(A) binding protein 1 (PABPN1) were methylated by HeLa cell extracts in vitro. By fractionation of these extracts followed by mass spectral analysis, we could demonstrate that the catalytic subunit PRMT5, together with its cofactor WD45, could symmetrically dimethylate CF I_m68, whereas pICln, the third polypeptide of the complex, was stimulatory. As sites of methylation in CF I_m68 we could exclusively identify arginines in a GGRGRGRF or “GAR” motif that is conserved in vertebrates. Further in vitro assays revealed a second methyltransferase, PRMT1, which modifies CF I_m68 by asymmetric dimethylation of the GAR motif and also weakly methylates the C-termini of both CF I_m59 and CF I_m68. The results suggest that native—as compared with recombinant—protein substrates may contain additional determinants for methylation by specific PRMTs. A possible involvement of CF I_m methylation in the context of RNA export is discussed.     

Overexpression of hyaluronan-binding protein 1 (HABP1/p32/gC1qR) in HepG2 cells leads to increased hyaluronan synthesis and cell proliferation by up-regulation of cyclin D1 in AKT-dependent pathway

Overexpression of the mature form of hyaluronan-binding protein 1 (HABP1/gC1qR/p32), a ubiquitous multifunctional protein involved in cellular signaling, in normal murine fibroblast cells leads to enhanced generation of reactive oxygen species (ROS), mitochondrial dysfunction, and ultimately apoptosis with the release of cytochrome c. In the present study, human liver cancer cell line HepG2, having high intracellular antioxidant levels was chosen for stable overexpression of HABP1. The stable transformant of HepG2, overexpressing HABP1 does not lead to ROS generation, cellular stress, and apoptosis, rather it induced enhanced cell growth and proliferation over longer periods. Phenotypic changes in the stable transformant were associated with the increased "HA pool," formation of the "HA cable" structure, up-regulation of HA synthase-2, and CD44, a receptor for HA. Enhanced cell survival was further supported by activation of MAP kinase and AKT-mediated cell survival pathways, which leads to an increase in CYCLIN D1 promoter activity. Compared with its parent counterpart HepG2, the stable transformant showed enhanced tumorigenicity as evident by its sustained growth in low serum conditions, formation of the HA cable structure, increased anchorage-independent growth, and cell-cell adhesion. This study suggests that overexpression of HABP1 in HepG2 cells leads to enhanced cell survival and tumorigenicity by activating HA-mediated cell survival pathways.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Feasibility of Provider-Initiated HIV Testing and Counselling of Tuberculosis Patients Under the TB Control Programme in Two Districts of South India

Background

Provider-initiated HIV testing and counselling (PITC) is internationally recommended for tuberculosis (TB) patients, but the feasibility, effectiveness, and impact of this policy on the TB programme in India are unknown. We evaluated PITC of TB patients across two districts in India considered to have generalized HIV epidemics, Tiruchirappalli (population 2.5 million) and Mysore (population 2.8 million).

Methodology/Principal Findings

Starting June 2007, healthcare providers in both districts were instructed to ascertain HIV status for all TB patients, and refer those with unknown HIV status to the nearest Integrated Counselling and Testing Centre (ICTC)—often in the same facility—for counselling and voluntary HIV testing. All TB patients registered from June 2007 to March 2008 were followed prospectively. Field investigators assessed PITC practices and abstracted data from routine TB programme records and HIV counselling registers to determine the proportion of TB patients appropriately evaluated for HIV infection. Patient records were traced to determine the efficiency of referral links to HIV care and antiretroviral treatment (ART). Between July 2007 and March 2008, 5299 TB patients were registered in both study districts. Of the 4701 with unknown HIV status at the time of TB treatment initiation, 3368 (72%) were referred to an ICTC, and 3111 (66%) were newly tested for HIV. PITC implementation resulted in the ascertainment of HIV status for 3709/5299 (70%) of TB patients, and detected 200 cases with previously undiagnosed HIV infection. Overall, 468 (8.8%) of all registered TB patients were HIV-infected; 177 (37%) were documented to have also received any ART.

Conclusions

With implementation of PITC in India, HIV status was successfully ascertained for 70% of TB patients. Previously undiagnosed HIV-infection was detected in 6.4% of those TB patients newly tested, enabling referral for life-saving anti-retroviral treatment. ART uptake, however, was poor, suggesting that PITC implementation should include measures to strengthen and support ART referral, evaluation, and initiation.