The heme environment of ovoperoxidase as determined by optical spectroscopy

Native ovoperoxidase exhibited an optical absorption spectrum with certain similarities to lactoperoxidase, but not horseradish peroxidase, over the pH range 4.5-11.5. Ovoperoxidase had three distinct spectral forms dependent on pH, with transitions at apparent pKa values of 6.6 and 3.0. Complexes of ovoperoxidase with CN-, N3-, F-, or when reduced and ligated to carbon monoxide, CN-, or pyridine, were distinct from other peroxidases. Ovoperoxidase formed two specific and different spectral derivatives at pH 6.0 and 8.0, either in the native state, or when combined with CN-, when reduced, or when reduced and ligated to CN-. The position of the Soret band when mixed with near-stoichiometric amounts of H2O2. This cycling was inhibited by phenylhydrazine, 3-amino-1,2,4-triazole, or low pH (less than or equal to 6). Compound II was formed when ovoperoxidase was mixed with ethyl hydrogen peroxide in a 1:3 ratio, but not with H2O2. With a great excess of H2O2, Compound III was formed at pH 8.0; at pH 6.0 or below, the Soret band shifted slightly with excess of H2O2, but Compound III was never formed. Even when ovoperoxidase was bound to proteoliaisin (Weidman, P. J., and Shapiro, B. M. (1987) J. Cell Biol. 105, 561-567), ovoperoxidase exhibited spectral characteristics of the free enzyme.     

Kinetic studies of lysine-sensitive aspartate kinase purified from maize suspension cultures

Steady state substrate kinetics and feedback regulation properties were determined for lysine-sensitive aspartate kinase (AK) purified from Black Mexican Sweet maize (Zea mays L.) cell suspension cultures. Two AK isoforms (AK Early and AK Late) were separated by two passages through an anion exchange column as the final steps in a procedure giving 1200-fold purification. Kinetic properties were determined for the major AK Late eluting isoform. Assays were conducted at the pH activity maximum (8.0) and with excess Mg²⁺ to favor a two-substrate reaction involving aspartate and complexed MgATP. AK catalyzed a sequential reaction in which MgATP and aspartate both bind to the enzyme complex before the ADP and aspartyl-phosphate products are released. The K_m value calculated for MgATP was 0.43 millimolar and for aspartate was 1.04 millimolar. Cooperativity in substrate binding was not observed and was not induced by lysine. The lysine concentration required for 50% inhibition of AK activity was 7 micromolar. An apparent Hill coefficient of 1.4 indicated a minimum of two lysine-binding sites on the active AK complex. At nonsaturating substrate concentrations, lysine inhibition was characteristic of an S-parabolic, I-parabolic noncompetitive allosteric inhibitor. The parabolic inhibitor replot, Hill coefficients > 1, and the lack of substrate cooperativity were consistent with a model for multiple lysine-binding sites per active AK subunit. Similar kinetic properties were observed for the AK Early isoform.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Selection and characterization of sethoxydim- tolerant maize tissue cultures

`Black Mexican Sweet' (BMS) maize (Zea mays L.) tissue cultures were selected for tolerance to sethoxydim. Sethoxydim, a cyclohexanedione, and haloxyfop, an aryloxyphenoxypropionate, exert herbicidal activity on most monocots including maize by inhibiting acetyl-coenzyme A carboxylase (ACCase). Selected line B10S grew on medium containing 10 micromolar sethoxydim. Lines B50S and B100S were subsequent selections from B10S that grew on medium containing 50 and 100 micromolar sethoxydim, respectively. Growth rates of BMS, B10S, B50S, and B100S were similar in the absence of herbicide. Herbicide concentrations reducing growth by 50% were 0.6, 4.5, 35, and 26 micromolar sethoxydim and 0.06, 0.5, 5.4, and 1.8 micromolar haloxyfop for BMS, B10S, B50S, and B100S, respectively. Sethoxydim and haloxyfop concentrations that inhibited ACCase by 50% were similar for BMS, B10S, B50S, and B100S. However, ACCase activities were 6.01, 10.7, 16.1, and 11.4 nmol HCO₃⁻ incorporated per milligram of protein per minute in extracts of BMS, B10S, B50S, and B100S, respectively, suggesting that increased wild-type ACCase activity conferred herbicide tolerance. Incorporation of [¹⁴C]acetate into the nonpolar lipid fraction was higher for B50S than for BMS in the absence of sethoxydim providing further evidence for an increase in ACCase activity in the selected line. In the presence of 5 micromolar sethoxydim, [¹⁴C]acetate incorporation by B50S was similar to that for untreated BMS. The levels of a biotin-containing polypeptide (about 220,000 molecular weight), presumably the ACCase subunit, were increased in the tissue cultures that exhibited elevated ACCase activity indicating overproduction of the ACCase enzyme.     

Kinetics of the spontaneous organization of microtubules in solution

Optically anisotropic zones occur spontaneously in solutions of microtubules. These tactoids, in which microtubules are arranged in parallel arrays, can be visualized by their birefringence. With microtubules assembled in the presence of associated proteins (MAPs), birefringence appears immediately after nucleation of polymerization, even at relatively low protein concentrations. It is not dependent on whether the assembly is initiated by temperature jump or by isothermal addition of GTP. With pure tubulin, assembled in buffers containing 25% glycerol or 4% dimethylsulfoxide and/or taxol, birefringence appears within a few hours, but it can be speeded up by gentle agitation. With tubulin assembled in the presence of MAPs, spontaneous orientation occurs simultaneously with polymerization. This may be due to the existence of more pronounced repulsive forces between microtubules when they are covered with MAPs. A simple calculation of the covolume, suggests that tactoid formation is expected for microtubules of lengths of 5 to 10 m at protein concentrations in the range 1 to 3 mg/ml (as observed), and that repulsive forces will promote tactoid formation at even lower protein concentrations. Offprint requests to: Y. Engelborghs     

Patterns of divergence during evolution of alpha 1-proteinase inhibitors in mammals

alpha 1-Proteinase inhibitor (alpha 1-PI), a member of the serine proteinase inhibitor superfamily, has a primary role in controlling neutrophil elastase activity within the mammalian circulation. Several studies have indicated that the reactive center region of alpha 1-PI, the amino acid sequence of which is critical to recognition of and binding to target proteinases, is highly divergent within and among species. This appears to be a consequence of accelerated rates of evolution that may have been driven by positive Darwinian selection. In order to examine this and other features of alpha 1-PI evolution in more detail, we have isolated and sequenced cDNAs representing alpha 1- PI mRNAs of the mouse species Mus saxicola and Mus minutoides and have compared these with a number of other mammalian alpha 1-PI mRNAs. Relative to other mammalian mRNAs, the extent of nonsynonymous substitution is generally high throughout the alpha 1-PI mRNA molecule, indicating greater overall rates of amino acid substitution. Within and among mouse species, the 5'-half of the mRNA, but not the 3'-half, has been homogenized by concerted evolution. Finally, the reactive center is under diversifying or positive Darwinian selection in murid rodents (rats, mice) and guinea pigs yet is under purifying selection in primates and artiodactyls. The significance of these findings to alpha 1-PI function and the possible selective forces driving evolution of serpins in general are discussed.      

Genetic and amino-acid analysis of two maize threonine-overproducing,lysine-insensitive aspartate kinase mutants

The aspartate-derived amino-acid pathway leads to the production of the essential amino-acids lysine, methionine, threonine and isoleucine. Aspartate kinase (AK) is the first enzyme in this pathway and exists in isoforms that are feedback inhibited by lysine and threonine. Two maize (Zea mays L.) threonine-overproducing, lysine-insensitive AK mutants (Ask1-LT19 and Ask2-LT20) were previously isolated. The present study was conducted to determine the map location of Ask2 and to examine the amino-acid profiles of the Ask mutants. The threonine-overproducing trait conferred by Ask2-LT20 was mapped to the long arm of chromosome 2. Both mutants exhibited increased free threonine concentrations (nmol/mg dry weight) over wild-type. The percent free threonine increased from approximately 2% in wild-type kernels to 37–54% of the total free amino-acid pool in homozygous mutant kernels. Free methionine concentrations also increased significantly in homozygous mutants. Free lysine concentrations were increased but to a much lesser extent than threonine or methionine. In contrast to previous studies, free aspartate concentrations were observed to decrease, indicating a possible limiting factor in threonine synthesis. Total (free plus protein-bound) amino-acid analyses demonstrated a consistent, significant increase in threonine, methionine and lysine concentrations in the homozygous mutants. Significant increases in protein-bound (total minus free) threonine, methionine and lysine were observed in the Ask mutants, indicating adequate protein sinks to incorporate the increased free amino-acid concentrations. Total amino-acid contents (nmol/kernel) were approximately the same for mutant and wild-type kernels. In five inbred lines both Ask mutations conferred the threonine-overproducing phenotype, indicating high expressivity in different genetic backgrounds. These analyses are discussed in the context of the regulation of the aspartate-derived amino-acid pathway.     

Comparison of the intermediate complexes of human growth hormone bound to the human growth hormone and prolactin receptors.

The crystal structures of complexes of human growth hormone (hGH) with the growth hormone and prolactin receptors (hGHR and hPRLR, respectively), together with the mutational data available for these systems, suggest that an extraordinary combination of conformational adaptability, together with finely tuned specificity, governs the molecular recognition processes operative in these systems. On the one hand, in the active 1:2 ligand-receptor complexes, 2 copies of the same receptor use the identical set of binding determinants to recognize topographically different surfaces on the hormone. On the other hand, comparing the 1:1 hGH-hGHR and hGH-hPRLR complexes, 2 distinct receptors use this same set of binding determinants to interact with the identical binding site on the ligand, even though few residues among the binding determinants are conserved. The structural evidence demonstrates that this versatility is accomplished by local conformational flexibility of the binding loops, allowing adaptation to different binding environments, together with rigid-body movements of the receptor domains, necessary for the creation of specific interactions with the same binding site.     

Characterization of Maize Acetyl-Coenzyme A Carboxylase

Maize (Zea mays L.) leaf acetyl-CoA carboxylase (ACCase) was purified about 500-fold by ammonium sulfate fractionation and gel filtration and blue Sepharose affinity and anion-exchange chromatography. Most ACCase activity (85%) recovered from the anion-exchange column was found in a highly purified fraction (specific activity 5.5 [mu]mol acid-stable product min-1 mg-1) that consisted primarily of a single 227-kD biotinylated polypeptide. The fraction represented 29% of the original activity and was designated ACCase I. A second partially purified ACCase activity (ACCase II) eluted earlier during anion-exchange chromatography, contained a single biotinylated polypeptide of 219 kD, was poorly recognized by antiserum raised against the ACCase I polypeptide, and was less inhibited by the herbicides haloxyfop or sethoxydim than was ACCase I. ACCase I and II both utilized propionyl-CoA as substrate about 50% as effectively as acetyl-CoA, and neither utilized methylcrotonyl-CoA. Immunoprecipitation with antiserum and protein blotting of crude extracts of leaf, embryo, and endosperm tissue and suspension cells indicated that most ACCase activity in these tissues was immunologically similar and consisted of ACCase I. Only leaves contained significant amounts of the ACCase II polypeptide; however, no ACCase II polypeptide was found in isolated mesophyll chloroplasts. The ACCase I and II polypeptides appear to be subunits of distinct ACCase isoforms.