Evolutionary ecology meets wildlife management: artificial group augmentation in the re-introduction of endangered African wild dogs (Lycaon pictus)

As an alternative to kin selection, group augmentation theory provides a framework for evolutionary mechanisms maintaining cooperative breeding when individual fitness is positively related to group size. It is expected that a cooperator group would accept or adopt unrelated foreigners when it is below a critical threshold size and group members could thus benefit from recruiting additional helpers. In re-introduction attempts, this would allow for a group to be augmented artificially before release, which would enhance its chance to establish itself successfully in the release area. This possibility was tested using endangered African wild dogs Lycaon pictus studied in Hluhluwe-iMfolozi Park, South Africa. Here, we report on the first successful artificial integration of an unrelated adult female with her three male pups into an existing pack. In addition, post-release monitoring data are presented, including how a yearling male displaced the dominant male that adopted him as a pup, adding to the controversy over the evolutionary stability of group augmentation as a route to cooperative breeding. This study thus demonstrates how theory from evolutionary ecology can be applied to practical wildlife management, and vice versa.     

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T-DNA loci

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.     

Development and characterization of microsatellite loci from Olea europaea

This study reports 19 simple sequence repeat loci developed from a genomic library of the olive tree (Olea europaea L.), of which 12 revealed to be polymorphic and informative, ranging from two to 14 alleles.     

Pyrazolopyridines as potent PDE4B inhibitors: 5-Heterocycle SAR

Following the discovery of 4-(substituted amino)-1-alkyl-pyrazolo[3,4-b]pyridine-5-carboxamides as potent and selective phosphodiesterase 4B inhibitors, [Hamblin, J. N.; Angell, T.; Ballentine, S., et al. Bioorg. Med. Chem. Lett. 2008, 18, 4237] the SAR of the 5-position was investigated further. A range of substituted heterocycles showed good potencies against PDE4. Optimisation using X-ray crystallography and computational modelling led to the discovery of 16, with sub-nM inhibition of LPS-induced TNF-α production from isolated human peripheral blood mononuclear cells.     

Brood size: a major factor influencing male dimorphism in the non‐pollinating fig wasp Sycobia sp.

• 1 Male polymorphisms have been described in some non‐pollinating fig wasps, as well as in other animals. The proximal basis and the maintenance of alternative male reproductive strategies are either genetic or environmental.
• 2 Here we studied male dimorphism in the non‐pollinating fig wasp Sycobia sp. We conducted experimental manipulations to study the factors influencing offspring male morph allocations and explore a possible basis for the determination and maintenance of male dimorphism in Sycobia sp.
• 3 The results showed that brood size was the major and underlying factor influencing the male morph ratio. When the brood size increases, the wingless male ratio also increases.
• 4 Also, our results indicated that there was no direct maternal control on offspring male morph allocation.
• 5 Male dimorphism in Sycobia sp. probably represents an environmentally determined conditional strategy, which responded to offspring population density at the level of the individual fig.

     

Acanthamoeba Interaction with Extracellular Matrix Glycoproteins: Biological and Biochemical Characterization and Role in Cytotoxicity and Invasiveness

ABSTRACT. Acanthamoeba are free-living amoebae that are dispersed in most environments. Occasionally, Acanthamoeba cause serious human infections, such as keratitis and encephalitis. During the infection process, amoebic adhesion to, and degradation of, host cells and their extracellular matrix (ECM) appear to be important requirements. We examined the interaction of Acanthamoeba with the ECM, and related this event to host cell destruction and tissue invasion. Pathogenic Acanthamoeba culbertsoni differentially attached on the ECM glycoproteins laminin-1, collagen-I, and fibronectin, as compared with non-pathogenic Acanthamoeba astronyxis . Binding to collagen-I and laminin-1 induced A. culbertsoni to become flattened and elongated. Because attachment on laminin-1 was higher in A. culbertsoni , laminin-1 was chosen for further analysis. A 55-kDa laminin-binding protein was identified in pathogenic amoebae, but it was not found in non-pathogenic amoebae. No differential cytotoxicity against distinct cell types was observed between A. culbertsoni incubated with or without ECM. On the other hand, binding on collagen-I or matrigel scaffolds induced a differential effect where A. culbertsoni invaded collagen-I matrices more rapidly. These results indicate that ECM recognition, as an antecedent to tissue invasion, may be a trait characteristic of pathogenic Acanthamoeba .     

First Record of the Peritrich Trichodina diaptomiBasson and Van As, 1991 (Protozoa: Ciliophora) on a South American Calanoid Notodiaptomus deitersi (Poppe, 1890) (Crustacea: Copepoda)

ABSTRACT. The ciliate Trichodina was recorded on the calanoid Notodiaptomus deitersi in a shallow, eutrophic reservoir, located in the centre‐west of Brazil. The species was confirmed as Trichodina diaptomi, a species widely distributed in Europe, Africa, Asia and Australia. It was observed moving freely over the carapace of the copepod, and using its adhesive disc. This is the first record for the species in the Americas.     

Paravahlkampfia francinae n. sp. Masquerading as an Agent of Primary Amoebic Meningoencephalitis

ABSTRACT. Paravahlkampfia francinae n. sp., a new species of the free-living amoeba genus Paravahlkampfia , designated as CDC:V595, was isolated from the cerebrospinal fluid of a patient with headache, sore throat, and vomiting, typical symptoms of primary amoebic meningoencephalitis (PAM) caused by Naegleria fowleri . The isolate grew at 33 °C, 37 °C, 40 °C, and 42 °C and destroyed mammalian cell cultures. However, it did not kill young mice upon intranasal inoculation. P. francinae does not produce flagellates and does not grow on agar plates coated with Gram-negative bacteria such as Escherichia coli , the usual food source of Paravahlkampfia ustiana , the type species of the genus. The trophozoite at light microscopy exhibited eruptive locomotion and possessed a single vesicular nucleus. Ultrastructurally, the trophozoites had numerous mitochondria with discoidal cristae but did not have a Golgi apparatus. The trophozoites differentiated into cysts after consuming most of the monolayer. The cyst had an inner well-differentiated endocyst and an outer thin, wrinkled, and wavy ectocyst with no pores. During excystation trophozoites ruptured the cyst wall and emerged from the cysts. A unique feature seen in the cysts was the presence of bacterial endosymbionts, both in the endoplasm and within the cyst wall. Full-length sequencing analysis of the 18S and 5.8S RNA genes of P. francinae showed that they were distinct from those of other Paravahlkampfia species. The patient recovered within a few days indicating that some of the previously reported cases of PAM that survived may have been due to P. francinae .