Fluorescence polarization and low-temperature absorption spectroscopy of a subunit form of light-harvesting complex I from purple photosynthetic bacteria

Measurements of polarized fluorescence and CD were made on light-harvesting complex 1 and a subunit form of this complex from Rhodospirillum rubrum, Rhodobacter sphaeroides, and Rhodobacter capsulatus. The subunit form of LH1, characterized by a near-infrared absorbance band at approximately 820 nm, was obtained by titration of carotenoid-depleted LH1 complexes with the detergent n-octyl beta-D-glucopyranoside as reported by Miller et al. (1987) [Miller J. F., Hinchigeri, S. B., Parkes-Loach, P. S., Callahan, P. M., Sprinkle, J. R., & Loach, P. A. (1987) Biochemistry 26, 5055-5062]. Fluorescence polarization and CD measurements at 77 K suggest that this subunit form must consist of an interacting bacteriochlorophyll a dimer in all three bacterial species. A small, local decrease in the polarization of the fluorescence is observed upon excitation at the blue side of the absorption band of the B820 subunit. This decrease is ascribed to the presence of a high-energy exciton component, perpendicular to the main low-energy exciton component. From the extent of the depolarization, we estimate the oscillator strength of the high-energy component to be at most 3% of the main absorption band. The optical properties of B820 are best explained by a Bchl a dimer that has a parallel or antiparallel configuration with an angle between the Qy transition dipoles not larger than 33 degrees. The importance of this structure is emphasized by the results showing that core antennas from three different purple bacteria have a similar structure.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Lysyl oxidase-mediated crosslinking in granulation tissue collagen in two models of hyperglycemia.

Enzymatically mediated crosslinks and nonenzymatic glycation were quantified in granulation tissue collagen in two models of hyperglycemia, diabetes and galactosemia, that have opposite effects on collagen solubility. The effects of castration, which alters collagen solubility, was also investigated. Collagen from both diabetic and galactosemic rats had significantly increased levels of dihydroxylysinonorleucine (DHLNL), a difunctional reducible crosslink. Galactosemic rats had significantly decreased levels of hydroxypyridinium, a trifunctional product of DHLNL and hydroxylysine, relative to control values, while diabetic rats had normal levels. Values for all other detectable crosslinks in collagen from hyperglycemic rats were indistinguishable from control values. Nonenzymatic glycation was increased in both groups of hyperglycemic rats. In diabetic rats, but not in galactosemic rats, nonenzymatic glycation was strongly correlated with DHLNL content. Castration had no effect on crosslink content of collagen from diabetic or galactosemic rats. This study demonstrates that (1) collagen crosslinking is abnormal in granulation tissue collagen in both experimental diabetes and galactosemia, (2) these changes are similar to those observed in skin collagen from insulin-dependent diabetic subjects and (3) the crosslinking abnormalities are not correlated with alterations in collagen solubility. We conclude that hyperglycemia-associated increases in immature crosslinks cannot account for altered collagen solubility, although impaired maturation of such crosslinks may be partially responsible for the lathyrogenic effect of galactosemia.     

Characterization of arylsulfatase C isozymes from human liver and placenta

Arylsulfatase C and steroid sulfatase were thought to be identical enzymes. However, recent evidence showed that human arylsulfatase C consists of two isozymes, s and f. In this study, the biochemical properties of the s form partially purified from human placenta were compared with those of the f form from human liver. Only the placental s form has steroid sulfatase activity and hydrolyses estrone sulfate, dehydroepiandrosterone sulfate and cholesterol sulfate. The liver f form has barely detectable activity towards these sterol sulfates. With the artificial substrate, 4-methylumbelliferyl sulfate, both forms demonstrated a similar KM but the liver enzyme has a pH optimum of 6.9 while the placental form displayed two optima at 7.3 and 5.5. The molecular weight of the native enzyme determined with gel filtration was 183,000 for the s form and 200,000 for the f form and their pI's were also similar at 6.5. However, the T50, temperature at which half of the enzyme activity was lost, was 49.5 degrees C for the f form and 56.8 degrees C for the s form. Polyclonal antibodies raised against the placental form reacted specifically against the s and not the f form. They immuno-precipitated concomitantly greater than 80% of the total placental arylsulfatase C and steroid sulfatase activities while less than 20% of the liver enzyme was immuno-precipitable. In conclusion, the two isozymes s and f of arylsulfatase C in humans purified from placenta and liver, respectively, have similar KM, pI' and native molecular weight. However, they are distinct proteins with different substrate specificity, pH optima, heat-lability and antigenic properties. Only the s form is confirmed to be steroid sulfatase.     

Effects of periodic backflushing on ultrafiltration performance.

Periodic backflushing was introduced to a membrane separation process to improve the performance. Hemoglobin (M.W. = 62,500) and dextran (M.W. = 10,000) were used as model compounds. Filtration performance of an ultrafiltration membrane system (Amicon hollow fiber membrane, H1P30-43, molecular weight cutoff = 30,000) was measured in terms of apparent permeability and retention coefficient of dextran to determine the effects of backflushing frequency and duration of one cycle. An optimum frequency around 0.2 min-1 existed to give a maximum permeability while the retention of dextran decreased with increasing frequencies. The improvement in permeability by periodic backflush was more than doubled. The retention of dextran decreased as backflushing duration was increased in one cycle. With the duration of 33.75 s, the retention of dextran was less than 50% and dextran output was 1.14 g/h, which was 1.3 times the value without backflushing. Also, periodic backflush made possible the long-term filtration of yeast cells for more than 20 h.     

Factors Affecting Germination of Oospores of Phytophthora infestans

When oospores from the pairing between A¹ and A² mating types of Phytophthora infestans were treated with 0.25 % KMnO₄ solution for 15 min and incubated at 19 °C under light on a modified S+L medium, germination commenced within 4 days and reached about 70 % after 20 days. Under these conditions, more than 25 % of oospores obtained from a 4-day-old culture germinated. To obtain a high germination rate of P. infestans oospores, light was essential during germination but not during growth and oospore formation. The optimum time for activation of oospores with 0.25 % KMnO₄ was 15 to 30 min and a suitable concentration of KMnO₄ for 15 min activation was 0.25 to 0.45 %.     

Quaternary structure of pigeon liver malic enzyme

Pigeon liver malic enzyme (EC 1.1.1.40) has a double dimer quaternary structure. The NADP+ analogs, aminopyridine adenine dinucleotide phosphate and nicotinamide-1,N6-ethenoadenosine dinucleotide phosphate, bind to the enzyme anti-cooperatively. In the presence of non-cooperative competing ligand NADP+, the binding parameter Hill coefficients of these analogues changed very little. Binding of L-malate with enzyme-AADP+ complex first enhanced then reduced the nucleotide fluorescence. Two L-malate binding sites, with Kd values of 23-30 and 270-400 microM, respectively. for the tight and weak binding sites were postulated. A hybrid model between the sequential and pre-existing asymmetrical models was proposed for the pigeon liver malic enzyme.     

Novel UGA-suppressors in Escherichia coli K-12

UGA-specific nonsense suppressors from Escherichia coli K-12 were isolated and characterized. One of them (Su+UGA-11) was identified as a mutant of the prfB gene for the peptide releasing factor RF2. It appears that in this strain, while peptide release at sites of UGA mutations is retarded, the UGA stop codon is read through even in the absence of a tRNA suppressor, exhibiting a novel type of passive nonsense suppression. Three suppressors (Su+UGA-12, -16 and -34) were capable of restoring the streptomycin sensitive phenotype in resistant bacteria (strAr). Because of their drug-related phenotype, these are possibly mutations in the components of the ribosomal machinery, particularly those concerned with peptide release at UGA nonsense codons. A tRNA suppressor was also obtained which was derived from the tRNA(Trp) gene. In this strain, a long region between rrnC (84.5 min) and rrnB (89.5 min) was duplicated and one of the duplicated genes of tRNA(Trp) was mutated to the suppressor. The mechanism of UGA-suppression is discussed in terms of translation termination at the nonsense codon in both active and passive fashions.     

Full-length sequence of the cDNA for human erythroid beta-spectrin

Spectrin is the major molecular consituent of the red cell membrane skeleton. We have isolated overlapping human erythroid beta-spectrin cDNA clones and determined 6773 base pairs of contiguous nucleotide sequence. This includes the entire coding sequence of beta-spectrin. The sequence translates into a 2137 amino acid, 246-kDa peptide. beta-Spectrin is found to consist of three distinct domains. Domain I, at the N terminus, is a 272-amino acid region lacking resemblance to the spectrin repetitive motif. Sequences in this region exhibit striking sequence homology, at both nucleotide and amino acid levels, to the N-terminal "actin-binding" domains of alpha-actinin and dystrophin. Between residues 51 and 270 there is 55% amino acid identity to human dystrophin, with only four single amino acid gaps in alignment. Domain II consists of 17 spectrin repeats. Several sequence variations are observed in typical repeat structure. Homology to alpha-actinin extends beyond domain I into the N-terminal portion of domain II. Domain III, 52 amino acid residues at the C terminus, does not adhere to the spectrin repeat motif. Combining knowledge of spectrin primary structure with previously reported functional studies, it is possible to make several inferences regarding structure/function relationships within the beta-spectrin molecule.     

Site-directed mutagenesis of glycine-14 and two "critical" cysteinyl residues in Drosophila alcohol dehydrogenase

Three amino acid residues (glycine-14, cysteine-135, and cysteine-218) previously speculated to be important for the structure and function of Drosophila melanogaster alcohol dehydrogenase have been investigated by using site-directed mutagenesis followed by kinetic analysis and chemical modification. Mutating glycine-14 to valine (G14V) virtually inactivates Drosophila ADH, and substitution of alanine at this position (G14A) causes a 31% decrease in activity. Thermal denaturation and kinetic and inhibition studies further demonstrate that replacing glycine-14 with either alanine or valine leads to structural changes in the NAD binding domain. These results provide direct evidence for the role played by glycine-14 in maintaining the correct conformation in the NAD binding domain. On the other hand, changing of cysteine-135, -218, or both to alanine (C135A, C218A, and C135A/C218A) causes no decrease in the catalytic activity of the enzyme, indicating that neither of the cysteinyl residues is essential for catalysis. C135A and wild-type enzyme are both inactivated by DTNB. In contrast, C218A and C135A/C218A are unaffected by DTNB treatment. DTNB modification of cysteine-218 can be prevented by the substrates NAD and 2-propanol, suggesting that cysteine-218 may be in the vicinity of the active site. Cysteine-135 which is normally insensitive to DTNB becomes accessible in the presence of 2-propanol and/or NAD, suggesting a conformational change induced by binding of these substrates.