The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Involvement of the respiratory chain of gram-negative bacteria in the reduction of tellurite

The terminal oxidases of the respiratory chain of seven strains of gram-negative bacteria were shown to be involved in the reduction of tellurite. The rate of tellurite reduction correlated with the intensity of respiration. The inhibitors of terminal oxidases, carbon monoxide and cyanide, inhibited the reduction of tellurite. In Pseudomonas aeruginosa PAO ML4262 and P. aeruginosa PAO ML4262 (pBS 10), the respiratory chain was found to contain three types of cytochrome c, one of which (the carbon monoxide-binding cytochrome c) was involved in the reduction of tellurite. Agrobacterium tumefaciens VKM B-1219, P. aeruginosa IBPM B-13, and Escherichia coli G0-102bd++ cells contained oxidases aa3, bb3, and bd, respectively. The respiratory chain of other strains contained two oxidases: E. coli DH5alpha of bb3- and bd-type, and Erwinia carotovora VKM B-567 of bo3- and bd-type. All the strains under study reduced tellurite with the formation of tellurium crystallites. Depending on the position of the active center of terminal oxidases in the plasma membrane, the crystallites appeared either in the periplasmic space [P. aeruginosa PAO ML4262 and P. aeruginosa PAO ML4262 (pBS10)], or on the outer surface of the membrane (A. tumefaciens VKM B-1219 and P. aeruginosa IBPM B-13), its inner surface (E. coli G0-102bd++), or on both surfaces (E. coli DHaalpha and E. carotovora VKM B-567).     

Detection of microarray-hybridized oligonucleotides with magnetic beads

The efficiency of hybridization analysis with oligonucleotide microarrays depends heavily on the method of detection. Conventional methods based on labeling nucleic acids with fluorescent, chemiluminescent, enzyme, or radioactive reporters suffer from a number of serious drawbacks which demand development of new detection techniques. Here, we report two new approaches for detection of hybridization with oligonucleotide microarrays employing magnetic beads as active labels. In the first method streptavidin-coated magnetic beads are used to discover biotin-labeled DNA molecules hybridized with arrayed oligonucleotide probes. In the second method biotin-labeled DNA molecules are bound first to the surface of magnetic beads and then hybridized with arrayed complementary strands on bead-array contacts. Using a simple low-power microscope with a dark-field illumination and a pair of complementary primers as a model hybridization system we evaluated sensitivity, speed, and cost of the new detection method and compared its performance with the detection techniques employing enzyme and fluorescent labels. It was shown that the detection of microarray-hybridized DNA with magnetic beads combines low cost with high speed and enhanced assay sensitivity, opening a new way to routine hybridization assays which do not require precise measurements of DNA concentration.     

Nucleotide sequence of the bacteriophage T5 DNA fragment which contains the gene for tRNAAsp

The nucleotide sequence of bacteriophage T5 tRNAAsp has been determined by conventional methods using thin-layer chromatography on cellulose for oligonucleotide fractionation. It exhibits several unusual features, such as (a) the displacement of the constant residues U-8, A-14 and R-15; (b) the presence of three G X U out of four base pairs in the D-stem. The gene for T5 tRNAAsp has been cloned in pBR 322 and sequenced. The analysis of the flanking regions shows the presence of two open reading frames on both sides of this gene. It has also been shown that the cloned gene is expressed in Escherichia coli, and RNase P is involved in the T5 tRNAAsp processing.     

A comparison of polypeptide compositions of individual <Emphasis Type="Italic">Agelena orientalis</Emphasis> spider venoms

Spider venoms are peculiar combinatory libraries of polypeptide molecules that specifically affect various cell targets. However, the question has remained up to now regarding whether the observed diversity of the polypeptides results from the synthesis of the complete library of these molecules by each individual spider or is due to the peculiarity of each zooid producing a limited set of components. We studied the composition of the mixed venom taken from several dozens of zooids of the Central Asian species of the Agelena orientalis and compared it with the venoms of 20 individual spiders of this species. The venoms were qualitatively and quantitatively analyzed by HPLC, mass spectrometry, and amino acid sequencing. It was shown that the individual venoms contain a lesser number of polypeptide components in comparison with the mixed venom and, in addition, differ from each other by the component composition. The set of components produced by single zooids is relatively narrow, and on the whole is a set identical to that of the mixed venom. The polypeptides with a high content in the venom were structurally characterized and compared with the amino acid sequences deduced from the cDNA library of this species.     

Conformational dynamics of the tetrameric hemoglobin molecule as revealed by hydrogen exchange: III. The influence of heme removal

Two main types of conformational fluctuations, local and global, are characteristic of the native protein structure and are detectable by hydrogen exchange. The probability of such fluctuations changes to a different degree during hemoglobin (Hb) oxygenation, changes in pH, and splitting of the intersubunit contracts. For comparison with the effect of heme removal, the rate of the hydrogen-deuterium (H-D) exchange of peptide H atoms (PHs) of human apoHb was studied by IR spectroscopy at pH 5.5–9.0 and temperatures of 10–38°C. The removal of heme increased the H-D exchange rate for 80% of Hb PHs with the exchange retardation factor P ～ 10²-10⁸. For the majority of PHs, the probability of local fluctuations depended weakly on the temperature; changes in enthalpy upon such local conformational transitions were ΔH _op ^o = 0–15 kcal/M. Global fluctuations, displaying a stronger temperature dependence, did not arise with an increase in temperature to 38°C at pH 7.0, although apoHb began slowly denaturing and aggregating under these conditions. Destabilization of the apoHb structure with a concurrent decrease in pH to 5.5 and temperature to 10°C intensified global fluctuations in the native protein structure with ΔH _op ^o < 0. The mechanism underlying the overall intensification of local fluctuations upon the heme removal, the specific features of apoHb heat denaturation under conditions close to those of in vivo Hb self-assembly, and the analogies between low-temperature global fluctuations and cold denaturation of globular proteins are discussed.     

Genomic Analysis of Pseudomonas putida Phage tf with Localized Single-Strand DNA Interruptions

The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure – a blunt right end and a 4-nucleotide 3′-protruding left end – was observed. Secondly, 14 single-chain interruptions (nicks) were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5′-TACT/RTGMC-3′. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.     

'Red pigment' from ADE-2 mutants of S. cerevisiae prevents DNA cleavage by restriction endonucleases

Protection of DNA from cleavage by restriction endonucleases EcoRI, HindIII, BamHI, and Bg/II with red pigment, produced by ADE-2 mutants of Saccharomyces cerevisiae is demonstrated. Purification of yeast DNA from pigment can be achieved by chromatography on hydroxyapatite columns.     

Focused genetic recombination of bacteriophage t4 initiated by double-strand breaks

A model system for studying double-strand-break (DSB)-induced genetic recombination in vivo based on the ets1 segCDelta strain of bacteriophage T4 was developed. The ets1, a 66-bp DNA fragment of phage T2L containing the cleavage site for the T4 SegC site-specific endonuclease, was inserted into the proximal part of the T4 rIIB gene. Under segC(+) conditions, the ets1 behaves as a recombination hotspot. Crosses of the ets1 against rII markers located to the left and to the right of ets1 gave similar results, thus demonstrating the equal and symmetrical initiation of recombination by either part of the broken chromosome. Frequency/distance relationships were studied in a series of two- and three-factor crosses with other rIIB and rIIA mutants (all segC(+)) separated from ets1 by 12-2100 bp. The observed relationships were readily interpretable in terms of the modified splice/patch coupling model. The advantages of this localized or focused recombination over that distributed along the chromosome, as a model for studying the recombination-replication pathway in T4 in vivo, are discussed.