Phylogenetic analysis of the coryneform bacteria by 5S rRNA sequences.

Nucleotide sequences of 5S rRNAs from 11 coryneform bacteria were determined. These were the type strains of Corynebacterium glutamicum, Corynebacterium xerosis, Brevibacterium linens, Arthrobacter globiformis, Cellulomonas biazotea, Aureobacterium testaceum, Curtobacterium citreum, Pimelobacter simplex, and Caseobacter polymorphus and representative strains of "Corynebacterium aquaticum" and Corynebacterium xerosis. A phylogenetic tree constructed from the sequences of these bacteria and published sequences indicated that the coryneform bacteria consist of a distinct eubacterial branch together with Streptomyces and Micrococcus spp. These bacteria could be further divided into four subgroups.     

4α-Methyl-5α-cholest-8(14)-en-3β-ol from the seeds of Capsicum annuum

A 4α-methylsterol was isolated from the seeds of Capsicum annuum and was identified as 4α-methyl-5α-cholest-8(14)-en-3β-ol. This seems to b     

Comparative lectin-binding and agglutination properties of the strain-specific,TA3-St,and the non-strain-specific,TA3-Ha,murine mammary carcinoma ascites sublines. Further studies of receptors in epiglycanin

The complex carbohydrates at the cell surfaces of two TA3, murine mammary carcinoma ascites sublines (the strain-specific, TA3-St subline and the nonstrain-specific, TA3-Ha line) were compared by binding studies with ¹²⁵I-labelled concanavalin A (con A), Ricinis communis agglutinin (RCA), and eel-serum agglutinin (ESA). The TA3-Ha cell bound equal amounts of con A, 1.5-fold more RCA, and 4-fold more ESA than the TA3-St cell. Binding-inhibition studies by these lectins and two others [wheat-germ agglutinin (WGA) and potato lectin (STA)] suggest complementary binding-sites between con A and both RCA and ESA. Quantitative agglutination studies with the five lectins, and inhibition determinations by both neuraminidase-treated and untreated epiglycanin revealed that TA3-St, but not TA3-Ha, cells were agglutinated by con A, and that epiglycanin inhibited this agglutination, as well as the agglutination of rabbit erythrocytes by con A. The presence of a con A receptor on epiglycanin was also suggested by the binding of epiglycanin to con A-Sepharose, and its specific elution with methyl α-d-manno-pyranoside. TA3-St cells were agglutinated at a 10-15-fold lower concentration of either STA or RCA than TA3-Ha cells, but both cells were agglutinated by the same concentration of WGA and ESA. Inhibition by epiglycanin of agglutination of TA3-St cells by either STA or ESA occurred at a concentration lower than that of TA3-Ha cells, but epiglycanin inhibited RCA agglutination of TA3-Ha cells at a concentration     

Studies on adenosine 3′,5′-monophosphate phosphodiesterase of human erythrocyte membranes

In this work we show the existence of cyclic AMP phosphodiesterase (EC 3.1.4.17) in human erythrocyte membranes and have clarified some properties of the enzyme. In human erythrocytes, about 23% of the total cyclic AMP phosphodiesterase activity is in a membrane-bound form. Although it could be solubilized with Triton X-100 in 5 mM Tris-HCl buffer (pH 8.0), it was not solubilized by a low or high concentration of salt. The enzyme seems to be localized in the cytoplasmic surface, since it is detected in sealed inside-out vesicles of human erythrocyte membranes, but not in intact human erythrocytes. The optimum pH was found to lie between 7.4 and 8.0, and Mg²⁺ was found to be necessary for its activity. Ca²⁺ and calmodulin could not stimulate the activity of this enzyme. Theophylline was a strong inhibitor, but cyclic GMP could not inhibit the enzymic hydrolysis of cyclic [³²P]AMP and this membrane-bound enzyme therefore seems to be specific to cyclic AMP.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

Chromosomal loci for 16S ribosomal RNA in Escherichia coli

Summary Genetic loci for 16S ribosomal RNA (rRNA) on the Escherichia coli chromosome were determined using the K-sequence, a characteristic oligonucleotide of strain K12, as a genetic marker. Oligonucleotide analyses of 16S rRNA from various recombinants between strain K12 and strain B(H) showed that the loci for 16S rRNA containing the K-sequence were near the metB locus which was at 77 min. on the chromosome map.     

Experimental Salmonellosis XI. Induction of Cellular Immunity and Formation of Antibody by Transfer Agent of Mouse Mononuclear Phagocytes

When mice were injected intraperitoneally with a ribonucleic acid (RNA) preparation extracted from the peritoneal mononuclear phagocytes (termed monocytes) of immunized mice, these macrophages developed cellular immunity and cellular antibodies. The peritoneal monocytes were obtained from normal mice and maintained in tissue culture bottles in a homogeneous cell population. When they were treated in vitro with an immune RNA preparation, they acquired cellular immunity, and cellular antibodies were detectable in such monocytes. These results suggest that the mononuclear phagocytic cell line constitutes a cell line responsible for antibody formation.     

Tannin-protein complex-degrading enterobacteria isolated from the alimentary tracts of koalas and a selective medium for their enumeration.

Tannin-protein complex (T-PC)-degrading enterobacteria (T-PCDE) were isolated from the feces and from a layer of bacteria attached to the cecal wall of koalas. The T-PCDE were facultatively anaerobic, gram-negative, pleomorphic, nonmotile bacilli. The bacteria were also oxidase and catalase negative and resistant to vancomycin, reduced nitrates to nitrites, and grew on MacConkey agar. Growth on tannin-treated agar media showed a distinctive clear zone around the colony. From these observations, a selective agar plate medium (vancomycin- and tannin-treated Wilkins-Chalgren anaerobe agar) was developed to enumerate T-PCDE isolated from the feces of koalas. This medium was highly selective in the enumeration of the fecal T-PCDE and inhibited the growth of concomitant T-PC-degrading Streptococcus bovis. The T-PCDE were isolated from 10 of the 12 captive koalas studied; in 8 of these 10 koalas, the facultatively anaerobic bacterial flora was dominated (more than 60%) by T-PCDE. Viable numbers of T-PCDE were, in most of the animals, much larger (more than 100 times) than the numbers of T-PC-degrading S. bovis, suggesting that T-PCDE played a more active role in digesting T-PC in the alimentary tracts of koalas.     

Purification and characterization of two types of Cytisus sessilifolius anti-H(O) lectins by affinity chromatography.

Two anti-H(O) lectins were separated from extracts of Cytisus sessilifolius seeds by successive affinity chromatographies on columns of di-N-acetylchitobiose- and galactose-Sepharose 4B. One was found to be inhibited most by di-N-acetylchitotriose or tri-N-acetylchitotriose [Cytisus-type anti-H(O) lectin designated as Cytisus sessilifolius lectin I (CSA-I)] and the other anti-H(O) lectin was inhibited by galactose or lactose and designated as Cytisus sessilifolius lectin II (CSA-II). These two anti-H(O) lectins were further purified by gel filtration on TSK-Gel G3000SW. These preparations were homogeneous as judged by polyacrylamide gel electrophoresis and gel filtration. The molecular masses of the purified lectins I and II were found to be 95,000 and 68,000 Da, respectively, by gel filtration on TSK-Gel G3000SW. On polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate and 2-mercaptoethanol, both lectins gave a single component of molecular masses of 27,000 +/- 2,000 and 34,000 +/- 2,000 Da, respectively, suggesting that the lectins I and II were composed of four and two apparently identical subunits, respectively. Lectins I and II contain 38% and 13% carbohydrate, respectively, and only very small amounts of cysteine and methionine, but they are rich in aspartic acid, serine and glycine. The N-terminal amino-acid sequences of these two lectins were determined and compared with those of several lectins already published.     

Characterization by NMR of the heme-myoglobin adduct formed during the reductive metabolism of BrCCl3. Covalent bonding of the proximal histidine to the ring I vinyl group

The reductive debromination of BrCCl3 by ferrous deoxymyoglobin leads to the covalent bonding of the prosthetic heme to the protein. We have previously shown, by the use of peptide mapping and mass spectrometry, that histidine residue 93 is covalently bound to the heme moiety. In the present study the structure of the heme adduct was more completely determined by 1H and 13C NMR techniques. We have found that the ring I vinyl group of the prosthetic heme was altered by the addition of a histidine imidazole nitrogen to the alpha-carbon and a CCl2 moiety to the beta-carbon. The electronic absorption spectra of the oxidized and reduced states of the altered heme-protein indicated that the heme-iron exists in a bis-histidine-ligated form. Analysis of the crystal structure of native myoglobin suggested that for the altered heme-protein, histidine residues 97 and 64 are ligated to the heme-iron and that residue 97 has replaced the native proximal histidine residue 93. These movements, in effect a "histidine shuffle" at the active site, may be responsible for the enhanced reducing activity of the altered protein.