How We Choose One over Another: Predicting Trial-by-Trial Preference Decision

Preference formation is a complex problem as it is subjective, involves emotion, is led by implicit processes, and changes depending on the context even within the same individual. Thus, scientific attempts to predict preference are challenging, yet quite important for basic understanding of human decision making mechanisms, but prediction in a group-average sense has only a limited significance. In this study, we predicted preferential decisions on a trial by trial basis based on brain responses occurring before the individuals made their decisions explicit. Participants made a binary preference decision of approachability based on faces while their electrophysiological responses were recorded. An artificial neural network based pattern-classifier was used with time-frequency resolved patterns of a functional connectivity measure as features for the classifier. We were able to predict preference decisions with a mean accuracy of 74.3±2.79% at participant-independent level and of 91.4±3.8% at participant-dependent level. Further, we revealed a causal role of the first impression on final decision and demonstrated the temporal trajectory of preference decision formation.     

Understanding the role of starch sheath layer in graviception of Alternanthera philoxeroides: a biophysical and microscopical study

Journal of Plant Research - Plants’ ability to sense and respond to gravity is a unique and fundamental process. When a plant organ is tilted, it adjusts its growth orientation relative to...     

Endogenous ocular lipids as potential modulators of intraocular pressure

Elevated intraocular pressure (IOP) is a risk factor in glaucoma, a group of irreversible blinding diseases. Endogenous lipids may be involved in regulation of IOP homeostasis. We present comparative fold analysis of phospholipids and sphingolipids of aqueous humour and trabecular meshwork from human control vs primary open-angle glaucoma and mouse control (normotensive) vs ocular hypertensive state. The fold analysis in control vs disease state was based on ratiometric mass spectrometric data for above classes of lipids. We standardized in vitro assays for rapid characterization of lipids undergoing significant diminishment in disease state. Evaluation of lipids using in vitro assays helped select a finite number of lipids that may potentially expand cellular interstitial space embedded in an artificial matrix or increase fluid flow across a layer of cells. These assays reduced a number of lipids for initial evaluation using a mouse model, DBA/2J with spontaneous IOP elevation. These lipids were then used in other mouse models for confirmation of IOP lowering potential of a few lipids that were found promising in previous assessments. Our results provide selected lipid molecules that can be pursued for further evaluation and studies that may provide insight into their function.     

Bacopasaponins with cytotoxic activity against human breast cancer cells in vitro

Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of...     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival

miRNA biogenesis enzyme Drosha cleaves double-stranded primary miRNA by interacting with double-stranded RNA binding protein DGCR8 and processes primary miRNA into precursor miRNA to participate in the miRNA biogenesis pathway. The role of Drosha in vascular smooth muscle cells (VSMCs) has not been well addressed. We generated Drosha conditional knockout (cKO) mice by crossing VSMC-specific Cre mice, SM22-Cre, with Drosha ^loxp/loxp mice. Disruption of Drosha in VSMCs resulted in embryonic lethality at E14.5 with severe liver hemorrhage in mutant embryos. No obvious developmental delay was observed in Drosha cKO embryos. The vascular structure was absent in the yolk sac of Drosha homozygotes at E14.5. Loss of Drosha reduced VSMC proliferation in vitro and in vivo. The VSMC differentiation marker genes, including αSMA, SM22, and CNN1, and endothelial cell marker CD31 were significantly downregulated in Drosha cKO mice compared to controls. ERK1/2 mitogen-activated protein kinase and the phosphatidylinositol 3-kinase/AKT were attenuated in VSMCs in vitro and in vivo. Disruption of Drosha in VSMCs of mice leads to the dysregulation of miRNA expression. Using bioinformatics approach, the interactions between dysregulated miRNAs and their target genes were analyzed. Our data demonstrated that Drosha is required for VSMC survival by targeting multiple signaling pathways.     

Differential Response of Chondrocytes and Chondrogenic-Induced Mesenchymal Stem Cells to C1-OH Tributanoylated N-Acetylhexosamines

Articular cartilage has a limited ability to self-repair because of its avascular nature and the low mitotic activity of the residing chondrocytes. There remains a significant need to develop therapeutic strategies to increase the regenerative capacity of cells that could repair cartilage. Multiple cell types, including chondrocytes and mesenchymal stem cells, have roles in articular cartilage regeneration. In this study, we evaluated a platform technology of multiple functionalized hexosamines, namely 3,4,6-O-tributanoylated-N-acetylgalactosamine (3,4,6-O-Bu₃GalNAc), 3,4,6-O-tributanoylated-N-acetylmannosamine (3,4,6-O-Bu₃ManNAc) and 3,4,6-O-Bu₃GlcNAc, with the potential ability to reduce NFκB activity. Exposure of IL-1β-stimulated chondrocytes to the hexosamine analogs resulted in increased expression of ECM molecules and a corresponding improvement in cartilage-specific ECM accumulation. The greatest ECM accumulation was observed with 3,4,6-O-Bu₃GalNAc. In contrast, mesenchymal stem cells (MSCs) exposed to 3,4,6-O-Bu₃GalNAc exhibited a dose dependent decrease in chondrogenic differentation as indicated by decreased ECM accumulation. These studies established the disease modification potential of a hexosamine analog platform on IL-1β-stimulated chondrocytes. We determined that the modified hexosamine with the greatest potential for disease modification is 3,4,6-O-Bu₃GalNAc. This effect was distinctly different with 3,4,6-O-Bu₃GalNAc exposure to chondrogenic-induced MSCs, where a decrease in ECM accumulation and differentiation was observed. Furthermore, these studies suggest that NFκB pathway plays a complex role cartilage repair.     

Characterization of haemoglobin from Actinorhizal plants – An in silico approach

Plant haemoglobins (Hbs), found in both symbiotic and non-symbiotic plants, are heme proteins and members of the globin superfamily. Hb genes of actinorhizal Fagales mostly belong to the non-symbiotic type of haemoglobin; however, along with the non-symbiotic Hb, Casuarina sp. posses a symbiotic one (symCgHb), which is expressed specifically in infected cells of nodules. A thorough sequence analysis of 26 plant Hb proteins, currently available in public domain, revealed a consensus motif of 29 amino acids. This motif is present in all the members of symbiotic class II Hbs including symCgHb and non-symbiotic Class II Hbs, but is totally absent in Class I symbiotic and non-symbiotic Hbs. Further, we constructed 3D structures of Hb proteins from Alnus and Casuarina through homology modelling and peeped into their structural properties. Structure-based studies revealed that the Casuarina symbiotic haemoglobin protein shows distinct stereochemical properties from that of the other Casuarina and Alnus Hb proteins. It also showed considerable structural similarities with leghemoglobin structure from yellow lupin (pdb id 1GDI). Therefore, sequence and structure analyses point to the fact that symCgHb protein shows significant resemblance to symbiotic haemoglobin found in legumes and may thus eventually play a similar role in shielding the nitrogenase from oxygen as seen in the case of leghemoglobin.     

Potential for Controlling Cholera Using a Ring Vaccination Strategy: Re-analysis of Data from a Cluster-Randomized Clinical Trial

IntroductionVaccinating a buffer of individuals around a case (ring vaccination) has the potential to target those who are at highest risk of infection, reducing the number of doses needed to control a disease. We explored the potential vaccine effectiveness (VE) of oral cholera vaccines (OCVs) for such a strategy.ConclusionsThese findings suggest that high-level protection can be achieved if individuals living close to cholera cases are living in a high coverage ring. Since this was an observational study including participants who had received two doses of vaccine (or placebo) in the clinical trial, further studies are needed to determine whether a ring vaccination strategy, in which vaccine is given quickly to those living close to a case, is feasible and effective.

Trial registration

ClinicalTrials.gov {"type":"clinical-trial","attrs":{"text":"NCT00289224","term_id":"NCT00289224"}}NCT00289224