The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.     

Stimulatory effects of quinpirole hydrochloride, D2-dopamine receptor agonist, at low concentrations on prolactin release in female rats in vitro.

Dopamine (DA) has dual actions (inhibitory and stimulatory) in the regulation of prolactin (PRL) release, depending on its concentration. To investigate the stimulatory effects of DA, perifused rat anterior pituitary cells were exposed to the highly-specific DA D2 receptor agonist, quinpirole hydrochloride (LY). Very low concentrations of LY (10(-12)-10(-10) M) stimulated PRL release and potentiated thyrotropin-releasing hormone (TRH)-induced PRL release. Higher concentrations of LY did not stimulate. Pretreatment with pertussis toxin (30 ng/ml, 24 h) completely abolished these effects of LY. The D2 receptor antagonist, metoclopramide, also blocked the potentiation by LY of TRH-induced PRL release. These data indicate that very low concentrations of dopamine stimulate PRL release via an interaction with a D2 receptor connected to a pertussis toxin-sensitive G protein.     

5-methoxyuridine: a new minor constituent located in the first position of the anticodon of tRNAAla, tRNAThr, and tRNAVal from Bacillus subtilis.

The sequences of the anticodon of tRNAAla, tRNAThr, and tRNAVal from Bacillus subtilis W 168 were N-G-C, N-G-U, and N-A-C, respectively. A new minor constituent, N, occupied the first position of the anticodon of each tRNA. N was indentified as 5-methoxyuridine (mo5U, Figure 1) by comparison of its UV absorption spectra, Rf values in thin-layer chromatography using several solvent systems and mass spectra with those of chemically synthesized specimen.     

Amino acid sequence of protein alpha-amylase inhibitor from Streptomyces griseosporeus YM-25

The amino acid sequence of a protein alpha-amylase inhibitor from Streptomyces griseosporeus YM-25 (Haim II), which consists of 77 amino acid residues, including two disulfide bridges, was determined by conventional methods. One of the disulfide bridges was found to be located between Cys(6) and Cys(22), and the other between Cys(40) and Cys(67) from the results of structure analyses of the two cystine-containing peptides obtained from the thermolysin digest of the native inhibitor.     

Amino acid sequence of Streptomyces metallo-proteinase inhibitor from Streptomyces nigrescens TK-23

Streptomyces Metallo-Proteinase Inhibitor (S-MPI) consists of 102 amino acid residues, including one methionine and two disulfide bridges. The complete amino acid sequence of S-MPI, including two disulfide bridges, was determined by sequencing of tryptic and chymotryptic peptides of two fragments obtained by cyanogen bromide cleavage followed by reduction and S-pyridylethylation of the protein. Incubation of the inhibitor with thermolysin slowly cleaved one peptide bond, Cys(64)-Val(65), which might be a reactive site of S-MPI.     

Interaction of thiolsubtilisin with Streptomyces subtilisin inhibitor, SSI.

Subtilisin BPN' was chemically converted to thiolsubtilisin and the interaction of this modified enzyme with Streptomyces subtilisin inhibitor (SSI) was examined. SSI competitively inhibited the esterolytic activity of thiolsubtilisin toward p-nitrophenyl acetate with a K1 value of 1.3 X 10(-5) M at pH 7.5 Spectrophotometric analysis of the interaction between SSI and the modified enzyme yielded a Kd value of 4 X 10(-5) M at pH 9.7. These values are about 10(5)-fold greater than the Kd value (less than 10(-9) M at pH 7.5) for the native enzyme. This indicates that the small change in the active site structure of subtilisin (Ser221 to Cys221) leads to a considerable decrease in the binding affinity (by about 6-7 kcal/mol) to SSI.     

Bacillus subtilis tRNA(Pro) with the anticodon mo5UGG can recognize the codon CCC

In Bacillus subtilis, four codons, CCU, CCC, CCA, and CCG, are used for proline. There exists, however, only one proline-specific tRNA having the anticodon mo(5)UGG. Here, we found that this tRNA(Pro)(mo(5)UGG) can read not only the codons CCA, CCG and CCU but also CCC, using an in vitro assay system. This means that the first nucleoside of its anticodon, 5-methoxyuridine (mo(5)U), recognizes A, G, U and C. On the other hand, it was reported that mo(5)U at the first position of the anticodon of tRNA(Val)(mo(5)UAC) can recognize A, G, and U but not C. A comparison of the structure of the anticodon stem and loop of tRNA(Pro)(mo(5)UGG) with those of other tRNAs containing mo(5)U at the first positions of the anticodons suggests that a modification of nucleoside 32 to pseudouridine (Psi) enables tRNA(Pro)(mo(5)UGG) to read the CCC codon.     

Toxoplasma gondii does not persist in goldfish (Carassius auratus)

Recent reports of toxoplasmosis in marine mammals raise concern that cold-blooded marine animals are a potential source of Toxoplasma gondii infection. To examine the transmissibility of T. gondii to fish, we observed the development of T. gondii tachyzoites inoculated into oviduct epithelial cells of goldfish (Carassius auratus) microscopically in vitro. Further, the survival period of tachyzoites inoculated into goldfish muscle was bioassayed in mice and through PCR analysis. In cell cultures at 37 C, both RH and Beverley strains of T. gondii tachyzoites had penetrated into cells at 6 hr post inoculation, and were multiplying. In cell cultures at 33 C, many tachyzoites of both strains attached to the host cells, but no intracellular tachyzoites were observed at 24 hr post inoculation. In the T. gondii inoculated goldfish kept at 33 C, tachyzoite DNA was detected in the inoculated region on day 3, but not on day 7. When inoculated goldfish were kept at 37 C, live tachyzoites were seen at the inoculation site on day 3, but not on day 7. These results suggest that T. gondii does not persist in fish.     

Molecular cloning and expression in Streptomyces lividans of a proteinous alpha-amylase inhibitor (HaimII) gene from Streptomyces griseosporeus

The gene encoding a proteinous alpha-amylase inhibitor (HaimII) of Streptomyces griseosporeus YM-25 has been cloned in Escherichia coli K12 using a deoxyinosine-containing synthetic oligonucleotide as the probe. A 1.6 kilobases BamHI fragment was confirmed to hybridize with the probe and subcloned in an E. coli-S. lividans shuttle vector. The plasmid clone was transferred into S. lividans by transformation. An appreciable amount of alpha-amylase inhibitor activity was found in the culture medium of S. lividans harboring the plasmid. As the specificity was indistinguishable from that of HaimII produced by the original S. griseosporeus strain, we concluded that the HaimII protein was synthesized in S. lividans and excreted into the medium.