Characterization of Avt1p as a vacuolar proton/amino acid antiporter in Saccharomyces cerevisiae

Several genes for vacuolar amino acid transport were reported in Saccharomyces cerevisiae, but have not well been investigated. We characterized AVT1, a member of the AVT vacuolar transporter family, which is reported to be involved in lifespan of yeast. ATP-dependent uptake of isoleucine and histidine by the vacuolar vesicles of an AVT exporter mutant was lost by introducing avt1? mutation. Uptake activity was inhibited by the V-ATPase inhibitor: concanamycin A and a protonophore. Isoleucine uptake was inhibited by various neutral amino acids and histidine, but not by γ-aminobutyric acid, glutamate, and aspartate. V-ATPase-dependent acidification of the vesicles was declined by the addition of isoleucine or histidine, depending upon Avt1p. Taken together with the data of the amino acid contents of vacuolar fractions in cells, the results suggested that Avt1p is a proton/amino acid antiporter important for vacuolar compartmentalization of various amino acids.     

Expression of HDL receptor, CLA-1 in human smooth-muscle cells and effect of interferon-gamma on its regulation.

High-density lipoprotein (HDL) exerts antiatherogenic effects by various mechanisms. The protective effect of HDL is thought to involve the reverse transport of cholesterol from cells in the arterial wall to the liver for disposal. We previously identified human scavenger receptor BI (hSR-BI/CLA-1) as a receptor for human HDL, but did not examine the expression of hSR-BI/CLA-1 in smooth-muscle cells. In this present study, a human aortic intima smooth-muscle cell line immortalized with SV 40 DNA was established, and the expression of hSR-BI/CLA-1 in this cell line analyzed by Western blot and RT-PCR. HSR-BI/CLA-1 mRNA and protein were detected in both this cell line and primary human aortic smooth-muscle cells. A cytokine, interferon-gamma (IFN-gamma) inhibited the hSR-BI/CLA-1 protein expression, but not mRNA expression. This observation confirmed that selective cholesterol ester uptake from HDL was inhibited by IFN-gamma. These results indicated that hSR-BI/CLA-1 may be expressed in human smooth-muscle cells, and the expression may be modulated by IFN-gamma. HSR-BI/CLA-1 on smooth-muscle cells could play an important role in atherogenesis.     

Thiazolidinedione inhibits production of RANTES in a cytokine-treated human lung epithelial cell line.

The chemokine RANTES is a potent chemoattractant for eosinophils. RANTES is produced by lung epithelial cells during eosinophil-rich inflammatory diseases such as asthma. In this study, we examined the effects of thiazolidinediones (TZD) on RANTES expression in a human lung epithelial cell line, A549. In A549 cells, interleukin-1beta and tumor necrosis factor-alpha induced endogenous RANTES protein secretion, mRNA expression, and promoter activity. The TZD inhibited these effects. Our data indicate that the suppression of the expression of RANTES can be accomplished by TZD treatment, raising the possibility that TZD might be of therapeutic value in diseases such as asthma.     

Thiazolidinedione inhibits the production of monocyte chemoattractant protein-1 in cytokine-treated human vascular endothelial cells.

The chemokine monocyte chemoattractant protein-1 is a potent chemoattractant for monocytes. Monocyte chemoattractant protein-1 is produced by vascular endothelial cells during inflammatory diseases such as atherosclerosis. In this study, we examined the effects of a thiazolidinedione on monocyte chemoattractant protein-1 expression in human vascular endothelial cells. In human vascular endothelial cells, interleukin-1beta and tumor necrosis factor-alpha induced endogenous monocyte chemoattractant protein-1 protein secretion, mRNA expression and promoter activity. The thiazolidinedione inhibited these effects. In summary, our results indicated that the suppression of the expression of monocyte chemoattractant protein-1 can be accomplished by thiazolidinedione treatment, raising the possibility that thiazolidinedione may be of therapeutic value in the treatment of diseases such as atherosclerosis.     

Plasma brain natriuretic peptide as a surrogate marker for cardioembolic stroke

Background

Cardioembolic stroke generally results in more severe disability, since it typically has a larger ischemic area than the other types of ischemic stroke. However, it is difficult to differentiate cardioembolic stroke from non-cardioembolic stroke (atherothrombotic stroke and lacunar stroke). In this study, we evaluated the levels of plasma brain natriuretic peptide in acute ischemic stroke patients with cardioembolic stroke or non-cardioembolic stroke, and assessed the prediction factors of plasma brain natriuretic peptide and whether we could differentiate between stroke subtypes on the basis of plasma brain natriuretic peptide concentrations in addition to patient's clinical variables.

Methods

Our patient cohort consisted of 131 consecutive patients with acute cerebral infarction who were admitted to Kagawa University School of Medicine Hospital from January 1, 2005 to December 31, 2007. The mean age of patients (43 females, 88 males) was 69.6 ± 10.1 years. Sixty-two patients had cardioembolic stroke; the remaining 69 patients had non-cardioembolic stroke (including atherothrombotic stroke, lacunar stroke, or the other). Clinical variables and the plasma brain natriuretic peptide were evaluated in all patients.

Results

Plasma brain natriuretic peptide was linearly associated with atrial fibrillation, heart failure, chronic renal failure, and left atrial diameter, independently (F_4,126 = 27.6, p < 0.0001; adjusted R² = 0.45). Furthermore, atrial fibrillation, mitral regurgitation, plasma brain natriuretic peptide (> 77 pg/ml), and left atrial diameter (> 36 mm) were statistically significant independent predictors of cardioembolic stroke in the multivariable setting (Χ² = 127.5, p < 0.001).

Conclusion

It was suggested that cardioembolic stroke was strongly predicted with atrial fibrillation and plasma brain natriuretic peptide. Plasma brain natriuretic peptide can be a surrogate marker for cardioembolic stroke.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

Formation of Complex of Proteinous Animal α-Amylase Inhibitor (Haim) with Hog Pancreatic α-Amylase

A limited proteolysis of Avicel-adsorbable, Avicel-disintegrating endocellulase I (molecular weight 130,000) from Geotrichum candidum with subtilisin yielded a protein (molecular weight 80,000) which proved fully active toward soluble substrates such as CM-cellulose, but lost both the abilities to be adsorbed onto insoluble substrates and to disintegrate the cellulose fibres. An immunological experiment showed precipitin lines between endocellulase I and subtilisin-modified endocellulase in the pattern of partial identity. N-Bromosuccinimide-oxidized endocellulase I lost cellulase activity, but retained its adsorbability onto Avicel. It is suggested that endocellulase I had both the affinity site for adsorbing onto insoluble substrates and the ordinary active site.