Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Preparation and in vitro evaluation of xanthan gum facilitated superabsorbent polymeric microspheres

Interpenetrating polymer network (IPN) hydrogel microspheres of xanthan gum (XG) based superabsorbent polymer (SAP) and poly(vinyl alcohol) (PVA) were prepared by water-in-oil (w/o) emulsion crosslinking method for sustained release of ciprofloxacin hydrochloride (CIPRO). The microspheres were prepared with various ratios of hydrolyzed SAP to PVA and extent of crosslinking density. The prepared microspheres with loose and rigid surfaces were evidenced by scanning electron microscope (SEM). Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) analysis confirmed the IPN formation. Differential scanning calorimetry (DSC) study was performed to understand the dispersion nature of drug after encapsulation. The in vitro drug release study was extensively evaluated depending on the process variables in both acidic and alkaline media. All the formulations exhibited satisfactory physicochemical and in vitro release characteristics. Release data indicated a non-Fickian trend of drug release from the formulations. Based on the results, this study suggest that CIPRO loaded IPN microspheres were suitable for sustained release application.     

Assessment of Soluble and Biomass K in Culture Medium Is a Reliable Tool for Estimation of K Releasing Efficiency of Bacteria

Abstract

Assessing the amount of released K from minerals in bacterial liquid culture is the main process for screening and isolation of efficient potassium releasing bacteria (KRB). This study was aimed to determine the amount of released K in solution phase or supernatant (SK) as well as microbial biomass K (MBK). Therefore, 20 different bacterial isolates belonging to the 10 bacterial genera (Beijerinckia, Klebsiella, Azotobacter, Pseudomonas, Agrobacterium, Rhizobium, Sphingomonas, Citrobacter, Microbacterium, and Achromobacter) were individually used to inoculate Aleksandrov medium in presence of biotite or muscovite. Our results from in-vitro experiments revealed that the MBK (K in pellet) is more important than in SK. Although some genera such as Azotobacter and Citrobacter released more SK (16?mg/l from biotite and 12.77?mg/l from muscovite, respectively), the Klebsiella isolates with the highest MBK could release an average of 90?mg/l total K. This study indicated that the assimilated K in microbial cells is the main part of K dissolution from minerals. Due to the fast turnover of nutrients in bacterial biomass, it can be concluded that both SK and MBK could be available for plants. It seems that the finding of this research should be considered in the isolation of KRB.

Highlights

• This study reports, assessment of soluble and biomass K in the culture medium is a reliable tool for estimation of K releasing efficiency of bacteria

• Our results from in vitro experiments revealed that the assimilated K in microbial cells is the main part of K dissolved from minerals.

• Although some genera such as Azotobacter released more K in solution phase, the Klebsiella isolates with the highest biomass K could release more total K

     

The field-dependence of the solid-state photo-CIDNP effect in two states of heliobacterial reaction centers

The solid-state photo-CIDNP (photochemically induced dynamic nuclear polarization) effect is studied in photosynthetic reaction centers of Heliobacillus mobilis at different magnetic fields by ¹³C MAS (magic-angle spinning) NMR spectroscopy. Two active states of heliobacterial reaction centers are probed: an anaerobic preparation of heliochromatophores (“Braunstoff”, German for “brown substance”) as well as a preparation of cells after exposure to oxygen (“Grünstoff”, “green substance”). Braunstoff shows significant increase of enhanced absorptive (positive) signals toward lower magnetic fields, which is interpreted in terms of an enhanced differential relaxation (DR) mechanism. In Grünstoff, the signals remain emissive (negative) at two fields, confirming that the influence of the DR mechanism is comparably low.     

Purification of clinical-grade disulfide stabilized antibody fragment variable—Pseudomonas exotoxin conjugate (dsFv-PE38) expressed in Escherichia coli

Immunotoxins are rationally designed cancer targeting and killing agents. Disulfide stabilized antibody Fv portion—toxin conjugates (dsFv-toxin) are third generation immunotoxins containing only the antibody fragment variable portions and a toxin fused to the V_H or V_L. Pseudomonas exotoxin fragment (PE-38) is a commonly used toxin in immunotoxin clinical trials. dsFv-toxin purification was previously published, but the recovery was not satisfactory. This report describes the development of a cGMP production process of the dsFv-toxin that incorporated a novel purification method. The method has been successfully applied to the clinical manufacturing of two dsFv-PE38 immunotoxins, MR1-1 targeting EGFRvIII and HA22 targeting CD22. The two subunits, V_L and V_H PE-38 were expressed separately in Escherichia coli using recombinant technology. Following cell lysis, inclusion bodies were isolated from the biomass harvested from fermentation in animal source component-free media. The dsFv-toxin was formed after denaturation and refolding, and subsequently purified to homogeneity through ammonium sulfate precipitation, hydrophobic interaction and ion-exchange chromatography steps. It was shown, in a direct comparison experiment using MR1-1 as model protein, that the recovery from the new purification method was improved three times over that from previously published method. The improved recovery was also demonstrated during the clinical production of two dsFv-PE38 immunotoxins—MR1-1 and HA22.     

Factors influencing the distribution of leopard in a semiarid landscape of Western India

Previously, factors governing distribution of leopard (Panthera pardus fusca) in forest habitats of the Indian subcontinent were unknown. The present study assessed the influence of different ecogeographic variables determining the distribution of leopards in and around Sariska Tiger Reserve through MaxEnt habitat suitability model based on camera trapping method. Camera trapping was used to collect presence/absence information in the study area from December 2008 to June 2010. Information of 11 macrohabitat characteristics and variables (habitat types, prey species, Normalized Difference Vegetation Index (NDVI), elevation, livestock, village, water source, etc.) were collected along with leopard presence data. The probability of presence of leopards increased with decreasing distance to water and increasing encounter rate of peafowl (Pavo cristatus), chital (Axis axis), sambar (Rusa unicolor), and wild pig (Sus scrofa). It was found that the probability of presence of leopards increased with increasing area of Zizyphus mixed forest patches and NDVI. Results of this study showed that the probability of presence of leopards was higher in habitat types with intermediate cover, high wild prey base, and water sources. They also indicated that leopards are not always ‘generalists’ showing some degree of specialization, at least in their choice of habitat, and this information is useful for conserving leopard in human-dominated landscapes.     

The inhibitory effects of Escherichia coli maltose binding protein on β-amyloid aggregation and cytotoxicity

The aggregation of β-amyloid (Aβ) peptide from its monomeric to its fibrillar form importantly contributes to the development of Alzheimer’s disease. Here, we investigated the effects of Escherichia coli maltose binding protein (MBP), which has been previously used as a fusion protein, on Aβ42 fibrillization, in order to improve understanding of the self-assembly process and the cytotoxic mechanism of Aβ42. MBP, at a sub-stoichiometric ratio with respect to Aβ42, was found to have chaperone-like inhibitory effects on β-sheet fibril formation, due to the accumulation of Aβ42 aggregates by sequestration of active Aβ42 species as Aβ42-MBP complexes. Furthermore, MBP increased the lag time of Aβ42 polymerization, decreased the growth rate of fibril extension, and suppressed Aβ42 mediated toxicity in human neuroblastoma SH-SY5Y cells. It appears that MBP decreases the active concentration of Aβ42 by sequestering it as Aβ42-MBP complex, and that this sequestration suppresses ongoing nucleation and retards the growth rate of Aβ42 species required for fibril formation. We speculate that inhibition of the growth rate of potent Aβ42 species by MBP suppresses Aβ42-mediated toxicity in SH-SY5Y cells.     

Efficacy of l-proline administration on the early responses during cutaneous wound healing in rats

Proline (Pro) plays a versatile role in cell metabolism and physiology. Pro and hydroxypro are major imino acids present in collagen, an important connective tissue protein, essential for wound healing, which is a primary response to tissue injury. This study explains the role of l-pro on cutaneous wound healing in rats when administered both topically and orally. Open excision wounds were made on the back of rats, and 200 μl (200 mg) of pro was administered topically and orally once daily to the experimental rats until the wounds healed completely. The control wounds were left untreated. Granulation tissues formed were removed after day 4 and 8 of post excision wounding, and biochemical parameters such as total protein, collagen, hexosamine, and uronic acid were estimated. Levels of enzymatic and non-enzymatic antioxidants such as catalase, superoxide dismutase, glutathione peroxidase, ascorbic acid, and reduced glutathione were evaluated along with lipid peroxides in the granulation tissues. Tensile strength and period of epithelialization were also measured. It was observed that the treated wounds healed very fast as evidenced by augmented rates of epithelialization and wound contraction, which was also confirmed by histological examinations. The results strappingly authenticate the beneficial effects of the topical administration of l-proline in the acceleration of wound healing than the oral administration and control.     

Historical Shifts in Brazilian P. falciparum Population Structure and Drug Resistance Alleles

Previous work suggests that Brazilian Plasmodium falciparum has limited genetic diversity and a history of bottlenecks, multiple reintroductions due to human migration, and clonal expansions. We hypothesized that Brazilian P. falciparum would exhibit clonal structure. We examined isolates collected across two decades from Amapá, Rondônia, and Pará state (n = 190). By examining more microsatellites markers on more chromosomes than previous studies, we hoped to define the extent of low diversity, linkage disequilibrium, bottlenecks, population structure, and parasite migration within Brazil. We used retrospective genotyping of samples from the 1980s and 1990s to explore the population genetics of SP resistant dhfr and dhps alleles. We tested an existing hypothesis that the triple mutant dhfr mutations 50R/51I/108N and 51I/108N/164L developed in southern Amazon from a single origin of common or similar parasites. We found that Brazilian P. falciparum had limited genetic diversity and isolation by distance was rejected, which suggests it underwent bottlenecks followed by migration between sites. Unlike Peru, there appeared to be gene flow across the Brazilian Amazon basin. We were unable to divide parasite populations by clonal lineages and pairwise FST were common. Most parasite diversity was found within sites in the Brazilian Amazon, according to AMOVA. Our results challenge the hypothesis that triple mutant alleles arose from a single lineage in the Southern Amazon. SP resistance, at both the double and triple mutant stages, developed twice and potentially in different regions of the Brazilian Amazon. We would have required samples from before the 1980s to describe how SP resistance spread across the basin or describe the complex internal migration of Brazilian parasites after the colonization efforts of past decades. The Brazilian Amazon basin may have sufficient internal migration for drug resistance reported in any particular region to rapidly spread to other parts of basin under similar drug pressure.     

Evaluation of Memory Enhancing Clinically Available Standardized Extract of Bacopa monniera on P-Glycoprotein and Cytochrome P450 3A in Sprague-Dawley Rats

Bacopa monniera is a traditional Ayurvedic herbal medicine used to treat various mental ailments from ancient times. Recently, chemically standardized alcoholic extract of Bacopa monniera (BM) has been developed and currently available as over the counter herbal remedy for memory enhancement in children and adults. However, the consumption of herbal drugs has been reported to alter the expression of drug metabolizing enzymes and membrane transporters. Present study in male Sprague-Dawley rat was performed to evaluate the effect of memory enhancing standardized extract of BM on hepatic and intestinal cytochrome P450 3A and P-glycoprotein expression and activity. The BM (31 mg/kg/day) was orally administered for one week in BM pre-treated group while the control group received the same amount of vehicle for the same time period. The BM treatment decreased the cytochrome P450 3A (CYP3A) mediated testosterone 6β-hydroxylation activity of the liver and intestine by 2 and 1.5 fold, respectively compared to vehicle treated control. Similarly pretreatment with BM extract decreased the expression of intestinal P-glycoprotein (Pgp) as confirmed by Western blot analysis but did not alter the expression of hepatic Pgp. To investigate whether this BM pretreatment mediated decrease in activity of CYP3A and Pgp would account for the alteration of respective substrate or not, pharmacokinetic study with carbamazepine and digoxin was performed in BM pre-treated rats and vehicle treated rats. Carbamazepine and digoxin were used as CYP3A and Pgp probe drugs, respectively. Significant increase in AUC and Cmax of carbamazepine (4 and 1.8 fold) and digoxin (1.3 and 1.2 fold), respectively following the BM pre-treatment confirmed the down regulation of CYP3A and Pgp.