排序方式: 共有458条查询结果,搜索用时 15 毫秒
31.
Changes in oxygen consumption rate and Na+/K+-ATPase activity during early development were studied in the sea urchin Paracentrotus lividus Lam. The oxygen consumption rate increased from 0.12 μmol O2 mg protein−1 h−1 in unfertilized eggs to 0.38 μmol O2 mg protein−1 h−1 25 min after fertilization. Specific activity of the Na+/K+-ATPase was significantly stimulated after fertilization, ranging up to 1.07 μmol Pi h−1 mg protein−1 in the late blastula stage and slightly lower values in the early and late pluteus stages. 相似文献
32.
Veljkovic M Dopsaj V Dopsaj M Branch DR Veljkovic N Sakarellos-Daitsiotis MM Veljkovic V Glisic S Colombatti A 《PloS one》2011,6(11):e28304
Background
There is convincing evidence from numerous clinical and epidemiological studies that physical activity can reduce the risk for breast and prostate cancer. The biological mechanisms underlying this phenomenon remain elusive. Herein we suggest a role for naturally produced antibodies reactive with the vasoactive intestinal peptide (VIP) in the suppression of breast and prostate cancer, which we believe could offer a possible molecular mechanism underlying control of these cancers by physical exercise.Methodology and Results
We found that sera from individuals having breast and prostate cancers have decreased titers of VIP natural antibodies as demonstrated by a lower reactivity against peptide NTM1, having similar informational and structural properties as VIP. In contrast, sera collected from elite athletes, exhibited titers of natural NTM1-reactive antibodies that are significantly increased, suggesting that physical activity boosts production of these antibodies.Significance
Presented results suggest that physical exercise stimulates production of natural anti-VIP antibodies and likely results in suppression of VIP. This, in turn, may play a protective role against breast and prostate cancers. Physical exercise should be further investigated as a potential tool in the treatment of these diseases. 相似文献33.
Transmembrane helix (TMH) topology prediction is becoming a focal problem in bioinformatics because the structure of TM proteins is difficult to determine using experimental methods. Therefore, methods that can computationally predict the topology of helical membrane proteins are highly desirable. In this paper we introduce TMHindex, a method for detecting TMH segments using only the amino acid sequence information. Each amino acid in a protein sequence is represented by a Compositional Index, which is deduced from a combination of the difference in amino acid occurrences in TMH and non-TMH segments in training protein sequences and the amino acid composition information. Furthermore, a genetic algorithm was employed to find the optimal threshold value for the separation of TMH segments from non-TMH segments. The method successfully predicted 376 out of the 378 TMH segments in a dataset consisting of 70 test protein sequences. The sensitivity and specificity for classifying each amino acid in every protein sequence in the dataset was 0.901 and 0.865, respectively. To assess the generality of TMHindex, we also tested the approach on another standard 73-protein 3D helix dataset. TMHindex correctly predicted 91.8% of proteins based on TM segments. The level of the accuracy achieved using TMHindex in comparison to other recent approaches for predicting the topology of TM proteins is a strong argument in favor of our proposed method. Availability: The datasets, software together with supplementary materials are available at: http://faculty.uaeu.ac.ae/nzaki/TMHindex.htm. 相似文献
34.
Novak-Laus K Mandić Z Iveković R Korsić J Tedeschi-Reiner E Masnec-Paskvalin S Bojić L 《Collegium antropologicum》2005,29(Z1):17-20
The patients with uveitic glaucoma are at high risk for failure following drainage surgery because of young age of these patients, preoperative long-term control of inflammation and postoperative complications. Twenty-two trabeculectomies performed in 22 patients with uveitic glaucoma were retrospectively evaluated to analyze the effect of intraoperative application of mitomycin C (MMC). Success rates, postoperative levels of intraocular pressure (IOP) and postoperative complications were studied. After a mean follow-up of 10.6 months (range, 5-28 months), 15 patients (68.2%) achieved IOP of 21mmHg or less without antiglaucoma medications. There were statistically significant reduction in IOP postoperatively during the period studied (p < 0.001). Early postoperative complications included chorioidal detachment (9.1%), shallow anterior chamber (9.1%), hyphema (13.6%), macular edema (4.5%) and raised IOP (27.3%). Late postoperative complications included exacerbation of uveitis (4.5%), macular edema (4.5%), cataract (22.7%) and raised IOP (31.8%). The eyes with raised IOP needed additional antiglaucoma medication. The results of this retrospective and uncontrolled study suggest that intraoperative application of MMC may be a good option for enhancement of short-term trabeculectomy success rates in patients with uveitic glaucoma. 相似文献
35.
In this article, authors have tried to answer the question: "Where is the place, and what is the meaning of the Oedipus complex in contemporary psychoanalysis?" The review of different theoretical standpoints was given, according to meaning and place of the Oedipus complex in human development. Although it depends on the resolving of preoedipal conflicts, the conflicts of phallic phases of the psychosexual development are universal to all human being, no matter how we call them--Oedipus, Electra or Persephone Complex. 相似文献
36.
Iveković R Novak-Laus K Tedeschi-Reiner E Masnec-Paskvalin S Sarić D Mandić Z 《Collegium antropologicum》2005,29(Z1):33-36
A chief morbidity of Graves eye disease is eyelid retraction and exophthalmus. Transpalpebral orbital fat removal accomplished with full thickness anterior blepharotomy was performed in 4 patients (5 orbits). Preoperative and postoperative ocular exposure symptoms, visual acuity, upper eyelid retraction and proptosis were evaluated. In all 5 operated orbits preoperative symptoms resolved; good results were achieved from the functional and cosmetic point of view. Full-thickness anterior blepharotomy combined with fat decompression is a safe and effective surgery for patients with upper eyelid retraction and exophthalmus due to enlarged orbital fat compartment. 相似文献
37.
Sovic A Panzenboeck U Wintersperger A Kratzer I Hammer A Levak-Frank S Frank S Rader DJ Malle E Sattler W 《Journal of neurochemistry》2005,94(1):109-119
Normal neurological function depends on a constant supply of polyunsaturated fatty acids to the brain. A considerable proportion of essential fatty acids originates from lipoprotein-associated lipids that undergo uptake and/or catabolism at the blood-brain barrier (BBB). This study aimed at identifying expression and regulation of endothelial lipase (EL) in brain capillary endothelial cells (BCEC), major constituents of the BBB. Our results revealed that BCEC are capable of EL synthesis and secretion. Overexpression of EL resulted in enhanced hydrolysis of extracellular high-density lipoprotein (HDL)-associated sn-2-labeled [(14)C]20 : 4 phosphatidylcholine. [(14)C]20 : 4 was recovered in cellular lipids, indicating re-uptake and intracellular re-esterification. To investigate local regulation of EL in the cerebrovasculature, BCEC were cultured in the presence of peroxisome-proliferator activated receptor (PPAR)- and liver X receptor (LXR)-agonists, known to regulate HDL levels. These experiments revealed that 24(S)OH-cholesterol (a LXR agonist), bezafibrate (a PPARalpha agonist), or pioglitazone (a PPARgamma agonist) resulted in down-regulation of EL mRNA and protein levels. Our findings implicate that EL could generate fatty acids at the BBB for transport to deeper regions of the brain as building blocks for membrane phospholipids. In addition PPAR and LXR agonists appear to contribute to HDL homeostasis at the BBB by regulating EL expression. 相似文献
38.
The extracellular ribonuclease barnase and its intracellular inhibitor barstar bind fast and with high affinity. Although extensive experimental and theoretical studies have been carried out on this system, it is unclear what the relative importance of different contributions to the high affinity is and whether binding can be improved through point mutations. In this work, we first applied Poisson-Boltzmann electrostatic calculations to 65 barnase-barstar complexes with mutations in both barnase and barstar. The continuum electrostatic calculations with a van der Waals surface dielectric boundary definition result in the electrostatic interaction free energy providing the dominant contribution favoring barnase-barstar binding. The results show that the computed electrostatic binding free energy can be improved through mutations at W44/barstar and E73/barnase. Furthermore, the determinants of binding affinity were quantified by applying COMparative BINding Energy (COMBINE) analysis to derive quantitative structure-activity relationships (QSARs) for the 65 complexes. The COMBINE QSAR model highlights approximately 20 interfacial residue pairs as responsible for most of the differences in binding affinity between the mutant complexes, mainly due to electrostatic interactions. Based on the COMBINE model, together with Brownian dynamics simulations to compute diffusional association rate constants, several mutants were designed to have higher binding affinities than the wild-type proteins. 相似文献
39.
Selak S Braun JE Fritzler MJ 《Biochemical and biophysical research communications》2004,323(4):1334-1342
The finding that patients and mice bearing autoantibodies directed against early endosome antigen 1 (EEA1) develop neurological signs and deficits prompted an investigation of EEA1 distribution, localization, and interaction with synaptic proteins found in neural tissues. We detected EEA1 in a variety of neural tissues and in cells of neural origin where it co-localized with SNAP-25. The interaction between EEA1 and SNAP-25 was dependent on the leucine zipper and a newly identified methyl-accepting domain of EEA1. The C-terminal zinc-binding FYVE finger motif (EEA1(1271-1411)) of EEA1 also interacted with native SNAP-25 but only in the presence of 100microM Ca(2+). In contrast, EEA1 did not bind to cysteine string protein or synapsin in these binding assays. These results suggest that EEA1 is involved in neuronal synaptic vesicle function and axonal transport and growth. EEA1 may undergo calcium-dependent conformational changes that are required for binding to SNAP-25. 相似文献
40.
Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation 总被引:2,自引:0,他引:2
Popović Hadzija M Radosevic S Kovacević D Lukac J Hadzija M Spaventi R Pavelić K Kapitanović S 《Mutation research》2004,548(1-2):61-73
Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers. 相似文献