Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Expression of an apoplast-directed, T-phylloplanin-GFP fusion gene confers resistance against Peronospora tabacina disease in a susceptible tobacco

Key message

Phylloplanins are plant-derived, antifungal glycoproteins produced by leaf trichomes. Expression of phylloplanin-GFP fusion gene to the apoplast of a blue mold susceptible tobacco resulted in increased resistance to this pathogen.

Abstract

Tobaccos and certain other plants secrete phylloplanin glycoproteins to aerial surfaces where they appear to provide first-point-of-contact resistance against fungi/fungi-like pathogens. These proteins can be collected by water washing of aerial plant surfaces, and as shown for tobacco and a sunflower phylloplanins, spraying concentrated washes onto, e.g., turf grass aerial surfaces can provide resistance against various fungi/fungi-like pathogens, in the laboratory. These results suggest that natural-product, phylloplanins may be useful as broad-selectivity fungicides. An obvious question now is can a tobacco phylloplanin gene be introduced into a disease-susceptible plant to confer endogenous resistance. Here we demonstrate that introduction of a tobacco phylloplanin gene—as a fusion with the GFP gene—targeted to the apoplasm can increase resistance to blue mold disease in a susceptible host tobacco.     

Drought resistance in rice seedlings conferred by seed priming

Seed priming is a method by which seeds are subjected to different stress conditions to impart stress adaptation in seedlings germinating and growing under stressful situations. Drought stress is a major reason behind failure of crops. We studied the effects of hydropriming, dehydration priming (induced by PEG), and osmopriming (induced by NaCl and KH₂PO₄) on subsequent germination, growth and anti-oxidant defense mechanisms of 2-week-old rice seedlings under continuing dehydration stress. Unprimed seeds grown in PEG showed significantly lower germination and growth along with significantly higher reactive oxygen species (ROS) and lipid peroxidation levels. Among the priming methods, 5 % PEG priming was found to be the best in terms of germination and growth rate along with the lowest amount of ROS and lipid peroxidation (malondialdehyde [MDA]) values. MDA levels were reduced significantly by all of the priming methods. Hence, reduction of lipid peroxidation may be a key factor underlying the drought tolerance produced by the priming treatments. Glutathione peroxidase (GPX) activity seemed to bear an excellent correlation with oxidative stress resistance through seed priming. The PEG priming produced minimum peroxidative damage and superior germination and growth rate along with efficient GPX activity, overexpressed MnSOD and maintenance of HSP70 expression in normal as well as in drought condition. Therefore, in PEG-primed seeds the existence of robust protective mechanisms is definitely indicated.     

Structure of the Essential Diversity-Generating Retroelement Protein bAvd and Its Functionally Important Interaction with Reverse Transcriptase

1. Download : Download high-res image (245KB)
2. Download : Download full-size image

Highlights? bAvd forms a highly positively charged pentameric barrel ? bAvd binds both DNA and RNA, but without sequence preference ? The coding sequence for bAvd serves dual purposes ? The interaction of bAvd with bRT is likely to be important for retrohoming     

Patient navigation pathway and barriers to treatment seeking in cancer in India: A qualitative inquiry

Cancer is a leading cause of mortality worldwide. Early diagnosis and treatment of cancer may curb the growing burden of the disease. Understanding cancer patients’ navigation pathways for seeking treatment is important in order to facilitate early diagnosis and treatment. With this background we conducted a hospital-based cross-sectional study comprising 68 randomly selected cancer inpatients in a tertiary cancer specialty hospital in Odisha, India, to explore the treatment-seeking pathways of the cancer patients and the barriers and enablers in seeking treatment. Financial constraint is one of the major reasons for the delay in accessing treatment, even when patients are suspected of or diagnosed with cancer. Low awareness of the presenting signs and symptoms of cancer and limited knowledge of the availability of cancer diagnosis and treatment facilities are major factors contributing to delay. Family and friends’ support is found to be the major enabling factor toward seeking treatment. Generation of awareness of cancer among the general population and primary-care practitioners – including those in alternative systems of medicine – is important. Information on diagnostic and treatment services appears to be a felt need.     

Binding interaction study on human serum albumin with bactericidal gold nanoparticles synthesized from a leaf extract of Musa balbisiana: a multispectroscopic approach

This study describes the eco‐friendly, low‐cost and room‐temperature synthesis of gold nanoparticles from Musa balbisiana leaf extract, which acts as both reducing and stabilizing agent, and characterized by ultraviolet?visible (UV–vis) light spectroscopy, fourier transform infrared (FTIR) spectroscopy, field emission scanning electron microscopy (FE‐SEM), analytical transmission electron microscopy (TEM), energy‐dispersive X‐ray spectroscopy (EDAX) and dynamic light scattering (DLS) instruments. These nanoparticles showed an average diameter of 33.83 ± 3.39 nm, which was confirmed from the size distribution histogram. The bactericidal activity of these nanoparticles was confirmed using bacteria Escherichia coli and Staphylococcus aureus at 1 and 2 nM minimum inhibitory concentrations, respectively. The interaction between nanoparticles and human serum albumin (HSA) was investigated, as this plays significant roles in biological systems. The nature of interaction, binding parameters and structural variation of HSA in the presence of these nanoparticles have been evaluated using several useful spectroscopic approaches such as UV–vis, FTIR, time‐resolved and steady‐state fluorescence, and circular dichroism in addition to the measurement of zeta potential. This interaction study revealed that static quenching occurs in this process with minimal alteration in the secondary structure, but the native structure of HSA remained unaltered. The binding constant and thermodynamic parameters of this interaction process were also evaluated.