In Vitro Alterations Do Not Reflect a Requirement for Host Cell Cycle Progression during Plasmodium Liver Stage Infection

Prior to invading nonreplicative erythrocytes, Plasmodium parasites undergo their first obligate step in the mammalian host inside hepatocytes, where each sporozoite replicates to generate thousands of merozoites. While normally quiescent, hepatocytes retain proliferative capacity and can readily reenter the cell cycle in response to diverse stimuli. Many intracellular pathogens, including protozoan parasites, manipulate the cell cycle progression of their host cells for their own benefit, but it is not known whether the hepatocyte cell cycle plays a role during Plasmodium liver stage infection. Here, we show that Plasmodium parasites can be observed in mitotic hepatoma cells throughout liver stage development, where they initially reduce the likelihood of mitosis and ultimately lead to significant acquisition of a binucleate phenotype. However, hepatoma cells pharmacologically arrested in S phase still support robust and complete Plasmodium liver stage development, which thus does not require cell cycle progression in the infected cell in vitro. Furthermore, murine hepatocytes remain quiescent throughout in vivo infection with either Plasmodium berghei or Plasmodium yoelii, as do Plasmodium falciparum-infected primary human hepatocytes, demonstrating that the rapid and prodigious growth of liver stage parasites is accomplished independent of host hepatocyte cell cycle progression during natural infection.     

6-Gingerol prevents cisplatin-induced acute renal failure in rats

BACKGROUND: Nephrotoxicity is a major complication and a dose limiting factor for cisplatin therapy. Recent evidence suggests that enhanced oxidative stress caused by oxygen-centered free radicals may contribute to the pathogenesis of cisplatin-induced acute renal failure. 6-Gingerol is claimed to be a potent antioxidant. The present study was performed to explore the renoprotective potential of 6-gingerol on cisplatin-induced oxidative stress and renal dysfunction. METHODS: 6-Gingerol in dosages of 12.5, 25, 50 mg/kg was administered 2 days before and 3 days after cisplatin administration. Renal injury was assessed by measuring serum creatinine, blood urea nitrogen, creatinine, urea clearance and serum nitrite levels. Renal oxidative stress was assessed by determining renal malondialdehyde levels, reduced glutathione levels and enzymatic activities of superoxide dismutase and catalase. RESULTS: A single dose of cisplatin resulted in marked renal oxidative and nitrosative stress and significantly deranged renal functions. 6-Gingerol treatment significantly and dose-dependently restored renal functions, reduced lipid peroxidation and enhanced the levels of reduced glutathione and activities of superoxide dismutase and catalase. CONCLUSIONS: The present study demonstrates the renoprotective potential of 6-gingerol against cisplatin-induced oxidative stress and renal dysfunction in rats. Hence, 6-gingerol has a potential to be used as therapeutic adjuvant in cisplatin nephrotoxicity.     

Treatment with 24-epibrassinolide,a brassinosteroid,increases the basic thermotolerance of Brassica napus and tomato seedlings

Brassinosteroids are plant growth-promoting compounds that exhibit structural similarities to animal steroid hormones. Recent studies have indicated that brassinosteroids are essential for proper plant development. In addition to a role in development, several lines of evidence suggest that brassinosteroids exert anti-stress effects on plants. However, the mechanism by which they modulate plant stress responses is not understood. We show here that Brassica napus and tomato seedlings grown in the presence of 24-epibrassinolide (EBR) are significantly more tolerant to a lethal heat treatment than are control seedlings grown in the absence of the compound. Since a preconditioning treatment of seedlings was not required to observe this effect, we conclude that EBR treatment increases the basic thermotolerance of seedlings. An analysis of heat shock proteins (HSPs) in B. napus seedlings by western blot analysis indicated that the HSPs did not preferentially accumulate in EBR-treated seedlings at the control temperature. However, after heat stress, HSP accumulation was higher in EBR-treated than in untreated seedlings. The results of the present study provide the first direct evidence for EBR-induced expression of HSPs. The higher accumulation of HSPs in EBR-treated seedlings raises the possibility that HSPs contribute, at least in part, to thermotolerance in EBR-treated seedlings. A search for factors other than HSPs, which may directly or indirectly contribute to brassinosteroid-mediated increase in thermotolerance, is underway.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Aging‐related anatomical and biochemical changes in lymphatic collectors impair lymph transport,fluid homeostasis,and pathogen clearance

The role of lymphatic vessels is to transport fluid, soluble molecules, and immune cells to the draining lymph nodes. Here, we analyze how the aging process affects the functionality of the lymphatic collectors and the dynamics of lymph flow. Ultrastructural, biochemical, and proteomic analysis indicates a loss of matrix proteins, and smooth muscle cells in aged collectors resulting in a decrease in contraction frequency, systolic lymph flow velocity, and pumping activity, as measured in vivo in lymphatic collectors. Functionally, this impairment also translated into a reduced ability for in vivo bacterial transport as determined by time‐lapse microscopy. Ultrastructural and proteomic analysis also indicates a decrease in the thickness of the endothelial cell glycocalyx and loss of gap junction proteins in aged lymph collectors. Redox proteomic analysis mapped an aging‐related increase in the glycation and carboxylation of lymphatic's endothelial cell and matrix proteins. Functionally, these modifications translate into apparent hyperpermeability of the lymphatics with pathogen escaping from the collectors into the surrounding tissue and a decreased ability to control tissue fluid homeostasis. Altogether, our data provide a mechanistic analysis of how the anatomical and biochemical changes, occurring in aged lymphatic vessels, compromise lymph flow, tissue fluid homeostasis, and pathogen transport.     

Therapeutic associated with occupational exposure to silica

Occupational exposure to silica dust has been increasing the possible risk of varieties of pathologies. The aim of this study was to evaluate the protective activity of ethanolic extract of Glycyrrhiza glabra roots at doses of 500 and 1000 mg/kg, p.o., given for 7 days against the toxicity of SiO(2) nanoparticles (50mg/kg intraperitoneal for 6 weeks) in rats. Exposure to silica altered various respiratory and biochemical variables, including ALT, AST, albumin, urea, uric acid, creatinine, catalase, LPO and GSH. Treatments with G. glabra extract significantly improved antioxidant status towards control. Stone workers in the Gwalior region exposed to silica dust had higher prevalence of cough, wheezing and shortness of breath. Increased serum ACE level was noted in the silica exposed group. It is of immense need to monitor this problem for betterment of worker's health.     

Methylmercury toxicity: amelioration by selenium and water‐soluble chelators as N‐acetyl cysteine and dithiothreitol

The protective potential of chelators, i.e. N‐acetyl cysteine (0.6 mg /kg, intraperitoneally) and dithiothreitol (15.4 mg kg^?1, intraperitoneally) with selenium (0.5 mg kg^?1, pre‐oral) were evaluated individually and in combination against methylmercury‐induced biochemical alterations and oxidative stress consequences. Forty‐two male Sprague–Dawley rats were exposed with methylmercury (1.5 mg kg^?1, pre‐oral) daily for 21 days followed by different treatments for five consecutive days. Administration of methylmercury caused significant enhancement in the release of transaminases, alkaline phosphatases and lactate dehydrogenases in serum. A significant increased was observed in lipid peroxidation level with a concomitant decreased in glutathione content after methylmercury exposure in liver, kidney and brain. Hepatic microsomal drug metabolizing enzymes (aniline hydroxylase and amidopyrine N‐demethylase) of cytochrome p4502E₁ showed sharp depletion after methylmercury exposure. Alterations in histological changes in liver, kidney and brain were also noted in methylmercury administered group. All treated groups showed recovery pattern, but the combined treatments with N‐acetyl cysteine and dithiothreitol in combination with selenium were more effective than that with either alone treatments in recovering blood biochemical changes after methylmercury toxicity. In conclusion, the results demonstrated that combination therapy may recover all blood biochemical alterations and offer maximum protection against methylmercury‐induced toxicity. Copyright © 2014 John Wiley & Sons, Ltd.